Over-expression of survivin in response to anti-cancer treatments has been demonstrated previously 24. Here, we examined the level of survivin expression in response to BPR0L075 treatment in various cancer cell lines. Human p53-wildtype KB and p53-mutated HONE-1 cancer cell lines were used in this study. Cells were treated with 8 nM (IC₅₀ value) of BPR0L075 for 24 h. Cell lysate was extracted and the expressions of various intracellular proteins were analyzed by western blotting. A time-dependent phosphorylation of Bcl2 in KB cells was shown and this result was consistent with our previously published data (Figure 1A) 12. Both un-treated cell lines expressed survivin endogenously (Figure 1A). In addition, the treatment of BPR0L075 (8 nM) induced over-expression of survivin in a time-dependent manner in both cancer cell lines (Figure 1A). Surprisingly, over-expression of a survivin negative-regulator, p53, in response to BPR0L075 was also observed in KB cells in a time-dependent manner (Figure 1A).

KB cells were chosen for further in vitro investigation, considering that the same cell line was chosen in our previously published report 12. To determine whether over-expression of survivin was unique to BPR0L075 treatment, KB cells were treated with 10 nM (IC₅₀ value) of colchicine (microtubule destabilizer) and intracellular proteins were analyzed by western blotting. Cells incubated with colchicine also induced over-expression of survivin in a time-dependent manner (Figure 1A, bottom panel). FACS analysis was performed to determine whether BPR0L075-induced over-expression of survivin was caused by cell cycle arrest at the G₂/M phase. KB cells were treated with various concentrations of BPR0L075 for 24 h and nucleus was stained with propidium iodide. Although high concentrations (≥ 16 nM, 2 × IC₅₀) of BPR0L075 induced G₂/M arrest, FACS analysis clearly showed no difference in the percentage of G₂/M population between untreated-cells and cells treated with 8 nM (IC₅₀ value) of BPR0L075 (Additional file 1).

To determine whether BPR0L075-induced over-expression of survivin in KB cells was caused by changes in the rate of survivin gene transcription, RT-PCR was performed. As was observed for the protein, the level of survivin mRNA transcripts was increased by approximately 3-fold in KB cells after 24 h of BPR0L075 incubation (Figure 1B). It has been suggested that p53 down-regulates the expression survivin 25. To determine whether p53 plays a role in the BPR0L075-induced over-expression of survivin in KB cells, a p53 inhibitor pifithrin-α was used. Interestingly, western blot analysis revealed that co-incubation pifithrin-α was unable to increase the level of survivin expression in BPR0L075-treated KB cells (Figure 1C). Taken together, these results suggest that p53-indpendent over-expression of survivin may affect cancer cells susceptibility to BPR0L075-induced cytotoxicity.

A KB-derived BPR0L075-resistant cancer cell line, KB-L30, was recently generated in our laboratory. This drug-resistant cell line was shown to withstand 30 nM of BPR0L075 under culturing condition (data not shown). In addition, this specific cell line showed resistance to colchicine in vitro (data not shown). Under BPR0L075-free conditions, western blot analysis revealed that the baseline expression of survivin was increased by approximate 2.3-fold in KB-L30 cells, as compared to the drug-sensitive KB cells (Figure 1D). Real-time PCR also revealed that the level of survivin mRNA transcripts was significantly increased by approximate 80% (*p < 0.01) in the KB-L30, as compared to its drug-sensitive parental cells (Figure 1E). FACS analysis was performed to determine whether over-expression of survivin in KB-L30 was caused by cell cycle arrest at the G₂/M phase. KB and KB-L30 cells cultured under BPR0L075-free coditions were stained with propidium iodide. FACS analysis clearly showed no significant difference in the percentage of G₂/M population between KB (16.3%) and KB-L30 (16.5%) cells (Additional file 1). Taken together, the detection of high levels of survivin in the BPR0L075-resistant KB-L30 cells suggests that intracellular survivin may affect cancer cells susceptibility to BPR0L075-induced cytotoxicity.

To investigate the sensitivity of cancer cells to the microtubule de-stabilizer, BPR0L075, after inhibition of survivin, siRNA was applied to down-regulate survivin in cancer cell lines, and the level of cell viability was examined. Cells were transfected with validated-siRNA oligomers, siR-C (scramble control) or siR-S (survivin specific) by liposomal reagent. Down-regulation of survivin mRNA transcripts by siRNA in both KB and KB-L30 cells after 36 h of transfection was confirmed by RT-PCR (Fig. 2A). Successful down-regulation of survivin protein by siR-S after 48 h of transfection was shown by immunofluorescence microscopy (Figure 2B). Western blot analysis further confirmed that survivin protein levels were successfully down-regulated after 48 h of siRNA transfection (Figure 2C).

Morphologically, the survivin-targeted KB cells became round and slightly enlarged in size (Figure 3A). Although down-regulation of survivin by siR-S induced morphological changes in KB cells under BPR0L075-free conditions (Figure 3A), the same treatment did not reduce cell viability (Figure 3B). Interestingly, down-regulation of survivin by siR-S enhanced the sensitivity to BPR0L075 in KB cells in vitro. Co-treatment of siR-S and BPR0L075 significantly reduced cell viability of KB by 17–31% among various concentrations of BPR0L075 in vitro as compared to the drug alone treatment (Figure 3B).

We further examined the possibility of restoring the sensitivity to BPR0L075 by down-regulation of survivin in KB-L30 cells. Phase contrast microscopy and cell viability studies showed that down-regulation of survivin did not induce KB-L30 cells cell death under BPR0L075-free conditions (Figure 3C and 3D). In contrast, down-regulation of survivin by siR-S induced massive cell death in KB-L30 cancer cells under normal culture conditions (30 nM of BPR0L075) (Figure 3C and 3D). Co-treatment of siR-S and BPR0L075 reduced the viability of KB-L30 cells by 20–52% among various concentrations of BPR0L075 in vitro as compared to the drug alone treatment (Figure 3D).

We have previously demonstrated that colchicine induced over-expression of survivin in KB cells (Figure 1A). To determine whether down-regulation of survivin by siRNA also increases the sensitivity to colchcine in KB and KB-L30 cells, cells co-treated with siR-C/siR-S and colchicine were analyzed by cell viability assay. Interestingly, down-regulation of survivin by siR-S enhanced the sensitivity to colchicine in both KB and KB-L30 cells in vitro (Figure 3E). Taken together, our results indicate that survivin plays an important role in the sensitivity to microtubule de-stabilizers, BPR0L075 and colchicine, in both KB and KB-L30 cells.

BPR0L075-induced de-stabilization of microtubule has been shown in cancer cells 12. On the other hand, stabilization of microtubule networks has been suggested to induce drug-resistance of tubulin de-stabilizating agents in HUVEC cells 26. Therefore, microtubule polymerization status was investigated to determine whether survivin counteracts the effectiveness of BPR0L075 by interfering with the microtubule dynamics in KB cancer cells. Soluble and insoluble fractions of the cell lysate were extracted. Interestingly, survivin was not detected in the soluble fraction of both cell lines (Figure 4A). The amount of insoluble survivin in KB-L30 was increased by approximately 2.2-fold as compared to the BPR0L075-sensitive KB cells. In correlation, the amounts of insoluble α – and β-tubulin were also increased in KB-L30 cells (Figure 4A). In contrast, the amounts of soluble α – and β-tubulin were decreased in KB-L30 cells (Figure 4A). These results reveal a positive correlation between the expression of survivin and stabilization of microtubule.

Interaction between survivin expression and dynamic formation of the microtubule was shown by western blot analysis. Down-regulation of survivin by siR-S reduced the amount of insoluble α-tubulin in both KB and KB-L30 cells (Figure 4B and 4C). However, the same treatment did not induce any changes in the general expression of α-tubulin (Figure 4B and 4C). Tubulin acetylation is considered to be a marker of microtubule stabilization 2728. In our study, western blot analysis revealed that down-regulation of survivin by siR-S reduced the amount of intracellular acetylated α-tubulin in both KB and KB-L30 cells, as compared to siR-C treated control. The combination of siR-S and 8 nM of BPR0L075 further reduced the amount of acetylated α-tubulin, as compared to siR-S and drug alone treatment in KB cells (Figure 4D, top panel). In addition, combination of siR-S and 70 nM of BPR0L075 also reduced the amount of acetylated α-tubulin, as compared to siR-S and drug alone treatment in KB-L30 cells (Figure 4D, bottom panel). Immunofluorescent microscopy was used to provide visualization of the microtubule networks in cells. Untreated KB cells showed intact microtubule networks (Figure 4E). In contrast, down-regulation of survivin by siR-S induced disorganization of the microtubule networks (Figure 4E). Furthermore, the combination of siR-S and 4 nM of BPR0L075 induced synergistic microtubule depolarization and changes in cell morphology (Figure 4E). These results indicate that survivin stabilizes the microtubule networks and possibly counteracts the therapeutic effect of microtubule de-stabilizer, BPR0L075, by stabilizing tubulin polymers.

BPR0L075-induced microtubule de-stabilization and subsequent activation of caspase-3 has been shown in KB cells previously 12. Here, real-time caspase-3/-7 activity imaging was performed to determine whether de-stabilization of the microtubule networks by targeting survivin enhances the sensitivity to BPR0L075 in cancer cells via downstream caspase-3/-7 activations. Cells pre-transfected with siR-C and siR-S were incubated with BPR0L075 for various durations. The activities of caspases-3/-7 were measured with the MagicRed™ real-time caspase-3/-7 detection kit, and nuclei were counter-stained blue with a Hoechst dye.

In BPR0L075-free conditions, caspase-3/-7 activities were not detected in both cell lines (Figure 5A and 5B). KB-L30 cells were normally cultured in media with the presence of BPR0L075 (30 nM). In this condition, caspase-3/-7 activities were also not detected (Figure 5B, middle row). In contrast, high dose of BPR0L075 induced caspase-3/-7 activity in both KB (8 nM, IC₅₀ value) and KB-L30 (70 nM, IC₅₀ value) cells, as indicated by red fluorescence staining of the cytoplasm of cells (Figure 5A and 5B). Inhibition of survivin by siR-S did not induce caspase-3/-7 activities in both cell lines under drug-free conditions (Figure 5A and 5B). In addition, co-treatment of siR-S and 4 nM of BPR0L075 did not enhance caspase-3/-7 activities in KB cells, as compared to the BPR0L075 monotherapy at various time points (Figure 5C). Interestingly, down-regulation of survivin induced caspase-3/-7 activities in BPR0L075-cotreated KB-L30 cells (Figure 5B, middle row). Therefore, our results indicate that survivin directly or indirectly interferes with the caspase-3/-7 in KB-L30, but not in KB cells during BPR0L075 treatments.

Activation of caspase-3/-7 induces DNA fragmentation 2930. Nucleus degradation was observed with KB cells treated with 16 nM (twice of IC₅₀ value) of BPR0L075 after 72 h (data not shown). Here, massive nucleus degradation was observed in the siR-S/BPR0L075-cotreated KB-L30 cells (Figure 5B, white arrows). In contrast, intact nucleus was shown in the drug alone treatment (Figure 5B). Although caspase-3/-7 activities were not increased in the combination treatment, increased degradation of nucleus was shown in KB cells, as compared to the drug alone treatment (Figure 5A, white arrows). The early appearance of DNA fragmentation in KB cells under combination treatment was further confirmed by TUNEL assay (Figure 5D).

DNA fragmentation can be induced by caspase-independent mechanisms. Apoptosis-inducing factor (AIF) is a protein which induces large-scale DNA fragmentation during caspase-independent apoptosis 3132. The possibility that siRNA-mediated down-regulation of survivin would lead to the translocation of AIF was explored. KB cells were treated with siR-C, siR-S, or drug BPR0L075 alone, and AIF expression was examined by immunofluorescence microscopy using an anti-AIF antibody. The cytoplasm of cells treated with siR-C for 48 h was stained green with a ring-like pattern around the nucleus by the anti-AIF antibody, as was the cytoplasm of cells treated with BPR0L075 (Figure 6). In marked contrast, it was the nucleus that was stained green by the anti-AIF antibody in cells treated with the siR-S against survivin, suggesting that AIF translocated from cytoplasm to the nucleus when survivin was targeted with siRNA (Figure 6). Cells treated with a combination of siR-S and BPR0L075 induced similar phenotype to siR-S mono-treatment (Figure 6). Thus, caspase-independent cell death could be induced by down-regulation of survivin in KB cells.

The compound BPR0L075 was synthesized at the Division of Biotechnology and Pharmaceutical Research, National Health Research Institutes, Zhunan, Taiwan, ROC. BPR0L075 was obtained in 72% yield from 6-methoxyindole and 3,4,5-trimethoxybenzoyl chloride. The detailed synthetic method was previously published11

The human oral carcinoma cells (KB) were purchased from the American Type Culture Collection (ATCC, Manassas, VA). KB and human nasopharyngeal carcinoma (HONE-1) cells were cultured in RPMI 1640 medium (Gibco, Grand Island, NY), supplemented with 5% fetal bovine serum, penicillin (100 U/mL), streptomycin (100 μg/mL) and L-glutamine (0.29 mg/mL), at 37°C. The antibodies used in this study included: a mouse anti-α Tubulin antibody (Upstate Cell signaling, Lake Placid, NY), a mouse anti-β Tubulin antibody (BD PharMingen, Franklin Lakes, NJ), a mouse anti-Actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA), a rabbit anti-Survivin antibody (R&D Systems, Minneapolis, MN) and a rabbit anti-AIF antibody (R&D Systems, Minneapolis, MN), a mouse anti-Bcl2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA).

Human oral carcinoma cells (KB) were cultured in RPMI 1640 medium as previously described. BPR0L075-resistant cells were established from KB cells by exposure to increasing concentrations of BPR0L075. Briefly, KB cells were initially incubated in completed medium containing 5nM of BPR0L075 that yielded 40% cell survival for a period of 3~4 weeks, and the cells that proliferated were repeatedly subcultured in completed medium containing increasing concentrations of the drug (a 20% increment each time). Cells that grew exponentially in the presence of 30 nM of BPR0L075 were obtained and subcloned by dilution plating in 48-well plates. Individual clones were isolated. For maintenance, these subclones were cultured under conditions similar to those used for KB, except for an addition of BPR0L075 (30 nM).

Total RNA was extracted with using TRIzol reagent (Invitrogen, Carlsbad, CA) and complementary DNA was synthesized from RNA with the SuperScript™ First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Polymerase chain reaction was performed with target-specific primers. Survivin forward primer: 5' ATGGGTGCCCCGACGTT; Survivin reverse primer: 5' TCAATCCATGGCAGCCAG; GAPDH: 5' ACCACAGTCCATGCCATCAC and GAPDH reverse primer: 5' TCCACCACCCTGTTGCTGTA.

Expression level of Survinin transcript was determined by real-time reverse transcriptase (RT)-polymerase chain reaction (PCR) using a LightCycler instrument (Roche, Indianapolis, IN). Primers and Taqman probes were designed by Probe Finder™ http://www.universalprobelibrary.com. Taqman probes were from the Universal Probe Library: Survinin 49 and hGAPDH 17. Specific primers with following sequences were used: Survinin forward, 5' GCCCAGTGTTTCTTCTGCTT; Survivin reverse, 5'CCGGACGAATGCTTTTTATG; hGAPDH forward, 5' AGCCACATCGCTCAGACAC and hGAPDH reverse, 5' GCCCAATACGACCAAATCC. The real-time PCR condition was as follows: 1 cycle of initial denaturation at 95°C for 10 min, 45 cycles of amplification at 95°C for 10 s, 60°C for 30 s, and 72°C for 1 s, with a single fluorescence acquisition. GAPDH gene was used as an internal control.

Target-validated siRNA oligos (Santa Cruz Biotechnology, Santa Cruz, CA) were transfected into cells using the Lipofectamine-2000 reagent (Invitrogen, Carlsbad, CA). Briefly, cells were seeded onto 96-well plates or chamber-slides, and cultured overnight in 100 μl of antibiotic-free RPMI media. siRNA oligomers (8 pmol in 0.4 μl) were diluted in 25 μl of Opti-MEM^® I medium (Invitrogen, Carlsbad, CA) without serum, and then mixed with 0.2 μl of Lipofectamine-2000 transfection reagent for 25 min at room temperature. Cells were overlaid with the transfection mixture, and incubated for various times.

Cells were lysed with ice-cold lysis buffer (10 mM Tris, 1 mM EDTA, 1 mM DTT, 60 mM KCl, 0.5% NP-40 and protease inhibitors). Total cell lysates, fractions of supernatant or pellet were resolved on 10% and 12% polyacrylamide SDS gels under reducing conditions. The resolved-proteins were electrophoretically transferred to PVDF membranes (Amersham Life Science, Amersham, U.K.) for Western blot analysis. The membranes were blocked with 5% non-fat milk powder at room temperature for two hours, washed twice with PBST (1% Tween) and then incubated with primary antibody for 90 minutes at room temperature. The membranes were washed twice with PBST then subsequently incubated with a horseradish peroxidase-conjugated secondary antibody (dilution at 1:10000, Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreactivity was detected by Enhanced Chemiluminescence (Amersham International, Buckingham, U.K.) and autoradiography.

3 × 10³ cells in 100 μL of drug-free culturing medium were seeded onto 96-well plates for 24 hours before treatments. Cells were then treated with various concentration of BPR0L075 for 72 hours. 25 μL of MTT (5 mg/mL) was added into each sample and incubated for 4 hours, under 5% CO₂ and 37°C. 100 μL of lysis buffer (20% SDS, 50% DMF) was subsequently added into each sample and further reacted for 16 hours. IC₅₀ value resulting from 50% inhibition of cell growth was calculated graphically as a comparison with control growth.

Cells were cultured in 8-well chamber slides, fixed with 4% paraformaldehyde, and permeabilized with TPBS. They were incubated with primary antibody for 60 min at room temperature followed by FITC-conjugated secondary antibody. Slides were examined by microscopy using an Olympus BX50 microscope (Olympus optical co., LTD, Tokyo, Japan). Images were taken on the Olympus microscope with the use of software CoolSNAP (Roper Scientific, Inc.)

Caspase-3/-7 activity was analyzed with a MagicRed™-DEVD Caspase Detection Kit (Immunochemistry Technologies LLC, Bloomington, MN). Briefly, cells were cultured in chamber-slides and incubated with test agents. Cells were then incubated with caspase substrate MR-(DEVD₂) in culture medium for 60 min, and then with Hoechst 33342 stain for 15 min. Cells were viewed with a UV-enabled inverted-microscope at an excitation wavelength of 540 nm – 560 nm and emission at 610 nm.

Quantitative analysis of caspase-3/-7 activity was performed on 96-well plates. Cells were cultured on 96-well plates and incubated with test agents. Treated-cells were then incubated with caspase substrate MR-(DEVD₂) in culture medium for 90 min. Caspase-3/-7 activity was measured with a 96-well plate reader at an excitation wavelength of 590 nm and emission at 615 nm.

Cells were seeded and cultured in 8-well chamber-slides, and treated with various treatments. The cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min on ice, and permeabilized with TPBS at room temperature. Apoptotic cells were stained by the TUNEL agent using an In-Situ Apoptosis Detection TMR Kit (Roche Diagnostic, Mannheim, Germany). Cells were counter-stained with DAPI to detect nucleus, and examined by fluorescence microscopy.