Introduction of the TSLC1 gene or cDNA into adenocarcinoma-derived A549 cells restores its expression to normal levels and suppresses many tumorigenic properties of this line 78. We extended observations about the inhibitory effect of TSLC1 expression on A549 cell growth 8 by showing that 12.2 cells expanded to only 28% of A549 levels after five days (Table 1 and Fig. 1). This same result was seen with WST-1 reagent, which showed that 48 hours after plating there was a significantly reduced number of viable 12.2 cells relative to A549 (data not shown).

Differences in growth rates and cell cycle profiles between A549 and 12.2 led us to examine expression of several known checkpoint and signaling pathway genes using quantitative RT-PCR (qPCR). Alterations in the Ras/p53 pathway result in abnormal G1/S transition in some NSCLC 23. However, mRNA levels of HRAS, p19, RB1, and TP53 were not substantially different between A549 and 12.2 (Table 3). The minor differences in expression levels were not coordinately regulated in a way that would explain lengthening of the G1/S transition in 12.2 cells. We also examined MYC and cyclin D1 (CCND1), which promote G1 to S phase transition. Neither CCND1 nor MYC, its upstream regulator, were differentially expressed. Thus, neither of these established pathways appears to be responsible for the G1 delay.

Alterations in the Wnt/β-catenin pathway are commonly observed in colorectal cancers and other solid tumors, including NSCLC. We detected no differences in mRNA levels of three upstream genes in the Wnt/β-catenin pathway, disheveled (DVL1), adenomatosis polyposis coli (APC), and β-catenin (CTNNB1). However, transcriptional regulators downstream of β-catenin, TCF4, TCF7L2, and LEF1, were up-regulated in the suppressed 12.2 cell line, by 6.8-, 2.2-, and 3.4-fold, respectively (Table 3).

A549 cells are metastatic in experimental systems 24, and elevated TSLC1 expression is correlated with lower levels of metastasis and invasion in esophageal squamous cell carcinoma 25. Accordingly, we examined levels of several genes involved in angiogenesis and metastasis. Increased expression of the angiogenic factor, VEGF, is correlated with metastasis and poor prognosis in solid tumors 26. Surprisingly, this gene was up-regulated 4.2+/-0.3 fold in the suppressed 12.2 cells. Metalloproteinases have roles in various stages of primary tumor progression, invasion and metastasis. In A549 and 12.2, matrix metalloproteinase 1 (MMP1) showed no expression difference, while tissue inhibitor of metalloproteinase 1 (TIMP1) showed a small (2.2+/-0.2-fold) up-regulation in 12.2. These results show that some genes associated with metastasis are altered by TSLC1, but not necessarily as predicted by previously described pathways in tumorigenic cells.

We characterized changes in transcription factor (TF) expression more broadly using the TranSignal Protein/DNA Array I (Panomics Inc., Redwood City, CA). Of the 54 TFs analyzed, 4 were down-regulated 2-fold or more in the 12.2 line and 8 were up-regulated in 12.2 (Table 3). In general, those up-regulated in 12.2 have been previously associated with repression of tumorigenesis. E2F1, which regulates the G1/S phase transition and has tumor suppressor properties, is increased in 12.2, consistent with our results from cell cycle analysis. The signal transducer and activator of transcription (Stat) proteins, which promote cellular proliferation, were down-regulated in 12.2. Interestingly, several TFs commonly disregulated in cancer, including AP-1, c-Myb, Ets, Sp1, Myc-associated factor X, NFκB and p53, were not altered between A549 and 12.2. (For complete list of TFs analyzed, see http://www.panomics.com/PDarray1_references.htm. These results are consistent with qPCR expression analysis, which did not show differences in cDNA levels for TP53, MYC, and ETS2 (Table 3).

Subtractive hybridization was performed between A549 cells and the suppressed 12.2 cells to identify genes differentially expressed when TSLC1 is restored to normal levels. The procedure was performed in both directions to produce two populations of cDNA enriched for messages up-regulated in A549 or in 12.2, respectively. Each of the differentially expressed cDNA populations was hybridized to Genome Systems cDNA arrays, identifying 41 genes greatly over-expressed in the tumorigenic A549 line and 18 genes over-expressed in the suppressed 12.2 cell line (Table 3). The differentially expressed genes represented a variety of functional classes, including those with roles in cell proliferation, cell survival, protein phosphorylation, immune response, cell adhesion, or detoxification. Several genes whose products are localized to the mitochondria were also differentially expressed.

Relative transcript levels for 31 of the differentially-expressed genes were quantified using qPCR (Table 3). Expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and alpha-tubulin (TUBA1). qPCR showed that TSLC1 expression was 2.8+/-0.8 times higher in 12.2 than in A549, as expected. Twenty-one of the 31 genes analyzed by qPCR showed expression differences of 2-fold or more in the direction predicted by subtractive hybridization. One gene, complement component C5 (CCC5), showed a 13.8+/-4.7-fold down-regulation in 12.2 cells, contrary to results expected after subtractive hybridization. The nine remaining genes changed less than 2-fold.

Several genes involved in cellular proliferation were among those expressed at high levels in A549 but low levels in 12.2 (Table 3). Cadherin 11 (CDH11), which plays a role in cell-cell interactions was also down-regulated in 12.2. Furthermore, several mitochondrial genes were down-regulated in 12.2 (Table 3). The genes that were most highly up-regulated with the restoration of TSLC1 expression in 12.2 cells were the candidate tumor suppressor Ras-induced senescence 1 (RIS1), metallothionein 1G (MT1G) and metallothionein 1E (MT1E).

We compared gene expression in normal vs. tumor tissue to determine whether differences in 12.2 and A549 cells reflect changes that occur in vivo (Table 4). Tissue was recovered from pathological specimens and transcript levels were measured by qPCR, normalized to GAPDH as described 14. TSLC1 and RIS1 levels were lower than normal in 5/5 tumor specimens, while S100 calcium-binding protein P (S100P) and insulin-like growth factor binding protein 1 (IGFBP1) levels were elevated in 5/5 and 4/5 tumors, respectively. Thus, key differences observed between the transformed (A549) and suppressed (12.2) cell lines reflect physiological differences seen in tumor vs. normal tissue.

The A549 cell line (American Type Culture Collection [ATCC], Manassas, VA) was cultured in Dulbecco's modified Eagle's medium (Invitrogen Corp., Carlsbad, CA) supplemented with 10% fetal bovine serum (Hyclone Laboratories, Inc., Logan UT), 1X non-essential amino acids and 1% penicillin-streptomycin (Invitrogen Corp., Carlsbad, CA) in 5% CO₂. The suppressed 12.2 cell line was created by transfecting YAC derivative y939-95 into A549 cells 8. 12.2 cells were cultured under the same conditions as A549, with the addition of 500 μg/ml G418 (Mediatech, Inc., Herndon, VA), except for cell growth assays, in which G418 was omitted.

For the growth assays, duplicate aliquots of 5 × 10⁴ cells were plated in six-well dishes. After 24, 48, and 120 h, cells were trypsinized and three aliquots from each well were counted using a hemacytometer. The average of six counts (three each, for two wells) is reported here.

For the WST-1 cellular proliferation assay (Roche Applied Science, Indianapolis, IN), 1 × 10⁴ cells were cultured for 48 h. Samples were incubated with WST-1 reagent for 1 h, and absorbance was measured at 450 nm and 620 nm.

Five primary NSCLC tumors and corresponding non-cancerous lung tissues from the same patients were surgically resected and histologically diagnosed at National Cancer Center, Japan. All samples were immediately frozen after surgical resection and stored at -135°C. The analyses of human samples were carried out in accordance with the institutional guidelines.

Proteomic analysis was performed using the TranSignal Protein/DNA Array I (Panomics Inc., Redwood City, CA). Nuclear protein extracts from A549 or 12.2 were incubated with an excess of biotinylated cis-binding elements (CBE) of 54 common transcription factors (TFs). Unbound CBE were removed and the protein/DNA complexes were separated, leaving labeled CBE which represent the relative protein levels of the 54 TFs. These were hybridized to a DNA array and visualized using streptavidin-HRP. Hybridized probe was quantified using the AlphaImager v5.5 software (Alpha Innotech Corp. San Leandro, CA).

Total RNA was isolated from A549 and 12.2 using Trizol reagent (Invitrogen Corp.), and poly(A) mRNA was purified using the PolyATract mRNA Isolation System II (Promega, Madison, WI). Subtractive hybridization was performed between A549 and 12.2 in both directions using the PCR-Select cDNA Subtraction Kit (Clontech, Palo Alto, CA).

The enriched pools of cDNA were hybridized to human Gene Discovery Array cDNA nylon filters (Genome Systems, Inc., St. Louis, MO). Samples (15 μl) of the final PCR reaction from each subtractive hybridization reaction were radioactively labeled by random prime-labeling with [³²P]dCTP 3940 and purified using ProbeQuant G-50 Sephadex columns (Amersham Pharmacia Biotech, Inc., Piscataway, NJ). The filters were prehybridized for 2 h at 42°C in buffer consisting of 0.75 M NaCl, 0.1 M Na₂HPO₄, 0.1% Na₄P₂O₇-10H₂O, 0.15 M Tris (pH 7.5), 5X Denhardt's solution, 2% SDS, and 100 μg/ml sheared salmon testis DNA (Sigma-Aldrich, St. Louis, MO). Probes were hybridized overnight at 42°C in the same buffer.

The membranes were washed in 2X SSC for 5 min at room temperature, twice in 2X SSC with 1% SDS for 30 min at 68°C, and twice in 0.6X SSC with 1% SDS for 30 min at 68°C. The filters were then rinsed in room-temperature 2X SSC and placed on film for 3 days for the A549 over-expressed population and 2 weeks for the 12.2 over-expressed isolates. Identities of associated EST sequences for positive clones were obtained from the Genome Systems website http://reagents.incyte.com/GDA/geneID.html. EST sequences were analyzed by BLAST, using the non-redundant database to obtain gene annotation for positive clones.

RNA was isolated from A549, 12.2, or the antisense clones with Trizol reagent (Invitrogen Corp.) and used to generate cDNA using Superscript II reverse transcriptase (Invitrogen Corp.). Quantitative PCR (qPCR) was carried out using the LightCycler rapid thermal cycler system and the SYBR Green FastStart PCR kit (Roche Diagnostics Ltd., Lewes UK). Primers were used at 0.5 μM and MgCl₂ at 4 mM. Samples were heat-denatured for 10 min., then cycled 55 times at 95°C for 10 sec., 58°C for 5 sec., and 72°C for 20 sec. At the completion of the cycling, a melting curve analysis was performed to detect the presence of multiple products. A standard curve was generated based on serial dilutions of PAC 66B10 and primers for marker 66B10.SP6 (CCTGGTAGTGGATTTCCCAA and ATGCCATTCAGTTTGTTCCC). Samples were normalized to glyceraldehyde 3-phosphate (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA). Primers for each gene were designed using the Primer3 program http://www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi.

For the apoptosis assay, A549 and 12.2 cells were grown without antibiotic selection. Cells were trypsinized and stained with annexin V and propidium iodide as recommended (BD Biosciences Pharmingen, San Diego, CA). Cells were analyzed on a Becton Dickinson FACScan.

For cell cycle studies, 2 × 10⁶ cells were collected and resuspended in 1 ml cold PBS, and 4 ml of -20°C 100% ethanol was slowly added. Cells were stored at -20°C overnight, recovered by centrifugation and resuspended in 1 ml PBS. RNase A (20 μg/ml) (Sigma-Aldrich Chemical Co., St. Louis, MO) was added, and the samples were incubated at 37°C for 30 min. Samples were incubated in 100 μg/ml propidium iodide (Sigma-Aldrich Chemical Co.) at room temperature for at least 1 h prior to analysis on a Becton Dickinson FACScan.