Table 2

PCR primer pairs used in the present study

Rattus Norvegicus Gene

Forward Primer (5'-3')

Reverse Primer (5'-3')

Amplicon Length (bp)


FUT8

CCATCCTCGGCCTCCTTACT

ACTGGGACACCCACCACACT

101

GAPDH

ACTCTACCCACGGCAAGTTC

TACTCAGCACCAGCATCA

133

Ywhaz

AAAAAGGAGATGCAGCCGAC

GTTGAGGGCCAGACCCAGT

51


Fang et al. Molecular Cancer 2010 9:215   doi:10.1186/1476-4598-9-215

Open Data