Log on / register
BioMed Central home | Journals A-Z | Feedback | Support | My details
 
Open AccessHighly AccessResearch

Gene expression profiling of cancer stem cell in human lung adenocarcinoma A549 cells

Dong-Cheol Seo1 email, Ji-Min Sung1 email, Hee-Jung Cho1 email, Hee Yi1 email, Kun-Ho Seo2 email, In-Soo Choi3 email, Dong-Ku Kim4 email, Jin-Suk Kim1 email, Abd El-Aty AM1 email and Ho-Chul Shin1 email

1  Department of Veterinary Pharmacology and Toxicology College of Veterinary Medicine, Konkuk University, 1 Hwayang-dong, Kwangjin-gu, Seoul 143-701, Republic of Korea

2  Department of Public Health, College of Veterinary Medicine, Konkuk University, 1 Hwayang-dong, Kwangjin-gu, Seoul 143-701, Republic of Korea

3  Department of Infectious Diseases, College of Veterinary Medicine, Konkuk University, 1 Hwayang-dong, Kwangjin-gu, Seoul 143-701, Republic of Korea

4  Cell and Gene Therapy Research Institute, Pochon CHA University, CHA General Hospital, Seoul 135-081, Republic of Korea

author email corresponding author email

Molecular Cancer 2007, 6:75doi:10.1186/1476-4598-6-75

The electronic version of this article is the complete one and can be found online at: http://www.molecular-cancer.com/content/6/1/75

Received: 6 September 2007
Accepted: 22 November 2007
Published: 22 November 2007

© 2007 Seo et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The studies on cancer-stem-cells (CSCs) have attracted so much attention in recent years as possible therapeutic implications. This study was carried out to investigate the gene expression profile of CSCs in human lung adenocarcinoma A549 cells.

Results

We isolated CSCs from A549 cell line of which side population (SP) phenotype revealed several stem cell properties. After staining the cell line with Hoechst 33342 dye, the SP and non-side population (non-SP) cells were sorted using flow cytometric analysis. The mRNA expression profiles were measured using an Affymetrix GeneChip® oligonucleotide array. Among the sixty one differentially expressed genes, the twelve genes inclusive three poor prognostic genes; Aldo-keto reductase family 1, member C1/C2 (AKR1C1/C2), Transmembrane 4 L six family member 1 nuclear receptor (TM4SF1), and Nuclear receptor subfamily 0, group B, member 1 (NR0B1) were significantly up-regulated in SP compared to non-SP cells.

Conclusion

This is the first report indicating the differences of gene expression pattern between SP and non-SP cells in A549 cells. We suggest that the up-regulations of the genes AKR1C1/C2, TM4SF1 and NR0B1 in SP of human adenocarcinoma A549 cells could be a target of poor prognosis in anti-cancer therapy.

Background

Cancer stem cell hypothesis is the tumoral cells which have stem cell features such as self-renewal, high migration capacity, drug resistance, and aberrant differentiation which constitute the heterogeneous population of tumor [1,2]. Tissue-specific stem cells are defined by their ability to self-renew and to produce the well differentiated and functional cells within an organ. Differentiated cells are generally short-lived; in skin and blood for example, they are produced from a small pool of long-lived stem cells that last throughout the life [3-6]. Therefore, stem cells are necessary for tissue development, replacement, and repair [7]. On the other hands, the longevity of stem cells make them susceptible to accumulating genetic damage and thereby representing the growth root for cancer recurrence following treatment [8]. It was reported that some of the tumor stem cells can survive chemotherapy and support re-growth of the tumor mass [9].

Cancer stem cells (CSCs) were first identified in 1990s in hematological malignancies, mainly acute myelogenous leukemia (AML) and also in other subtypes like AML M0, M1, M2, M4, and M5, chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), and multiple myeloma [10,11]. CSCs are also known in solid tumors like breast, brain, lung, prostrate, testis, ovary, stomach, colon, skin, liver, and pancreas [12-17]. A character of stem cells, termed "side population (SP)", has been identified using Hoechst 33342 dye. The flow cytometric analysis makes sorting possible either to SP or non-SP cells. The SP cells have been isolated from various types of adult tissue where they demonstrate stem cell activity [18-23]. The findings of these previous studies suggest that the SP phenotype represents a common feature of stem cells.

We performed our work on human lung adenocarcinoma A549 cells (of which SP phenotype revealed several stem cell properties [24]) to identify the genes, which make the CSCs of poor prognostic phenotype and evaluate the gene expression intensities of SP and non-SP cells using oligonucleotide micro-array. The reasons why the A549 cell line was selected, because it has a relatively high proportion of SP cells compared to other cell lines [25] and is more chemo-resistant particularly to platinum drugs [26].

Results

The distinct gene regulations in SP cells

We sorted A549 cell line to SP and non-SP cells (Fig. 1) and compared the gene expression intensities of both cells. Official symbols and gene names were used in accordance with the symbol and name lists approved by HUGO (Human genome organization) Gene Nomenclature Committee (Table 1) [27]. Following data analysis, 12 genes were considered as up-regulated in SP cells (TM4SF1 has 2 probe ID) (fold changes are shown in Table 2), whereas, 49 genes were down-regulated (Fig. 2). Since we focused on distinct gene regulations, the student's t'-test was not employed to prevent loss of up-regulated genes in all of three chip data, though it had large chip variations.

thumbnailFigure 1. Sorting of SP and non-SP cells by FACSVantage SE.

Table 1. The approved gene symbols and names in reference to HUGO Gene Nomenclature

thumbnailFigure 2. Gene clustering of up-regulated genes in SP and non-SP cells. After normalizing each chip to the 50th percentile of the measurements taken that chip, gene-probes scored less than 0.1 either in SP or non-SP were excluded from data analysis. Only matched up-regulated genes in SP compared to non- SP cells are selected in each step of chip data analysis. The 12 genes and 46 genes were considered as up-regulated in SP and non-SP cells, respectively.

Table 2. Gene list up-regulated in SP cells compared to non-SP cells

Validation of gene regulations

To confirm the fold changes of AKR1C1 in chip data, quantitative real time – reverse transcriptase PCR was employed. The relative fold changes in SP compared to non-SP cells were 3.11 ± 0.92 and 2.88 ± 0.17 in microarray and qrt- rtPCR, respectively (Fig. 3).

thumbnailFigure 3. Relative fold changes of AKR1C1/C2 gene in SP and non-SP cells. The fold changes of AKR1C1/C2 between SP and non-SP cells were compared using GeneChip data and quantitative real time-reverse transcriptase PCR. The data (n = 3) were presented as mean ± SD.

Discussion

Based on the cancer stem cell hypothesis, we assumed that the up-regulation of certain genes that are related to poor prognosis (high migration capacity or drug resistance) in SP of cancer cells could be a target for therapeutic index. In the present study, we found some genes that are related to drug resistance, such as AKR1C1/C2 and NR0B1, or cancer metastasis, such as TM4SF1, were up-regulated in SP cells of human lung adenocarcinoma A549 cell line. Furthermore, the up-regulated gene, ABCG2, has been noticed to be as an indicator for sorting SP cells by Hoechst 33342 staining [24]. It was reported that ABCG2 pumping out the drugs was associated with multi-drug resistance in many cancers [28,29] and/or effects higher levels of DNA repair and hence lowered the ability to apoptosis [30].

AKR1C belongs to a superfamily of monomeric, cytosolic NADP(H)-dependent oxidoreductases that catalyzes the metabolic reduction and either activate or inactivate several xenobiotics [31,32]. In humans, at least four isoforms of AKR1C (AKR1C1~4) have been identified [33]. AKR1C1/AKR1C3 was known to inactivate progesterone, which could alter the progesterone/estrogen ratio in certain cancers [34,35]. Additionally, AKR1C1/C2 inhibitors were reported as potential anti-neoplastic agents [36,37]. The high expression of AKR1C was considered as a poor prognostic factor in patients with non-small-cell lung cancer [38], and it was enriched in hepatocellular carcinoma than normal hepatic cells [39]. A previous study evaluated the relationship between the AKR1C and drug resistance and revealed that the over expression of AKR1C1/C2 led to drug resistance in non-small-cell lung cancer cells [26]. A public database (Gene Expression Omnibus (GEO), NCBI) [40] has shown significant up-regulation of AKR1C1 in smokers (Figure 4A). Similar trends were also reported in lung cancer patients [41,42]. This means that smoking can alter the regulation of certain genes related to poor prognosis such as AKR1C1. Moreover, AKR1C1 was suggested as a marker of stem-like cells in thyroid cancer cell lines, though it was not proved by the authors [41].

thumbnailFigure 4. The up-regulation of AKR1C1 and TM4SF1 in smokers (derived from GEO public database). AKR1C1 (A) and TM4SF1 (B) were increased in current smoker compared to former or never smokers. TM4SF1 was increased in metastatic form compared to primary form of colon cancer (C).

From the data of GEO, the TM4SF1 gene, which is believed to be involved in cancer invasion and metastasis [44] was also up-regulated in smokers (Figure 4B), and metastatic form of colon cancer patients compared to primary form of colon cancer patients (Figure 4C). TM4SF1 was also suggested as a possible marker of stem-like cells in thyroid cancer cells [41]. However, we could not find out the GEO data that match to tumor genesis of the up-regulated NR0B1, though up-regulated NR0B1 gene was required for the transformed phenotype of certain sarcoma [45].

Conclusion

It is still unclear how the cancer stem cells express poor prognostic phenotype in cancer, but we found for the first time that several genes related to chemo-resistance and metastasis are up-regulated in SP cells compared to non-SP cells. Therefore, enrichment of AKR1C1/C2, TM4SF1 and NR0B1 in SP of A549 cells might be a target of poor prognosis in cancer therapy.

Methods

Cell culture

A549 cells, a representative human lung adenocarcinoma cell line, were obtained from American Type Culture Collection (ATCC, VA, USA). The cells were cultured on F-12K nutrient mixture, Kaighn's modification (1×) liquid (Gibco, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Genetron Life Technology, INC., CA, USA) and 1% of penicillin/streptomycin (P/S) (Gibco, CA, USA) on standard plastic tissue culture dishes (SPL Life Sciences, Seoul, Republic of Korea) and incubated in an atmosphere of 95% air/5% CO2 at 37°C.

Fluorescence activated cell sorting (FACS) for SP and non-SP cells

The cells were detached with trypsin (Gibco, CA, USA), washed with phosphate buffer solution (PBS)/2% FBS, and resuspended at 1 × 106 cells per ml in pre-warmed Hanks' balanced salt solution (HBSS; Gibco, CA, USA)/10% FBS. Hoechst 33342 dye (Sigma, St. Louis, MO, USA) was then added to this portion (final concentration: 5 μg/ml), and incubation continued for 90 min at 37°C. After washing with PBS/2% FBS, the cells re-suspended in ice-cold HBSS/10% FBS were labeled with 2 μg/ml propidium iodide (Sigma, St. Louis, MO, USA) to distinguish live from dead cells prior to analysis. SP analysis and sorting were done using a FACSVantage SE (BD Biosciences, CA, USA). The Hoechst 33342 dye excited at 350 nm using UV laser and the DM610 SP was used to distinguish the red from the blue fluorescence signals. The EF675-LP (Hoechst Red) and BP450/20 nm (Hoechst Blue) filters were then installed in front of the PMT detector.

RNA isolation and oligonucleotide microarray analysis

We prepared total RNA from approximately 2 × 106 SP or non-SP cells with Qiagen RNeasy Mini kit (Qiagen, CA, USA) according to the instruction of the manufacturer. The RNAs were subjected to GeneChip® expression array in full commercial service with two-cycle target labeling (SeouLin Bioscience, Seoul, Republic of Korea). Briefly, cDNA were synthesized from total RNA using T7-Oligo (dT) primers. Using that cDNA, biotinylated cRNA was then synthesized. Fifteen μg of the labeled cRNA was hybridized to a Human Genome U133 Plus 2.0 Array (Affymetrix, CA, USA). Array image was scanned and analyzed using Genechip operating software (GCOS) (Affymetrix, CA, USA).

Quantitative real-time rt-PCR (qrt-rtPCR)

To validate the fold changes in the expression intensity of SP and non-SP cells in microarray data, we performed qrt-rtPCR using SYBR Premix Ex Taq Perfect Real Time kit (TaKaRa Bio, Ohtsu, Japan) in a SmartCycler (Cepheid, CA, USA) according to the manufacturer's instruction. The cycle threshold value, which was determined using second derivative, was used to calculate the normalized expression of the indicated genes using Smartcycler Software (Cepheid, CA, USA). The following primer pairs were used: GAPDH (as an internal control); F-primer 5'CGACCACTTTGTCAAGCTCA3' and R-primer 5'AGGGGAGATTCAGTGTGGTG3', AKR1C1;AKR1C2; F-primer 5'GTGGAAGCTGACCAGGTTGT3' and R-primer 5'AAGCCGTGTTCTTTCTGCTG3'.

Microarray data analysis

We used GeneSpring GX 7.3.1 software (Agilent Technologies, CA, USA) to normalize and analyze the microarray data. Following normalization of each chip to the 50th percentile of the measurements taken that chip, probes (genes) scored less than 0.1 both in SP and non-SP cells were excluded from the data analysis. Only matched up-regulated genes in SP and non-SP cells were selected from each step of chip (gene expression microarray) data analysis. More than 2 fold changes in all chip data were considered as up-regulated. Standard curve method was used to analyze qrt-rtPCR for confirmation of fold changes in chip data.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

DS and HS conceived the study. DS, JS, HC and HY carried out the sample preparation, gene expression analyses and quantitative real time RT-PCR. DK contributed to stem cell preparation. KS, IC, JK, AMAE and HS participated in the design, reviewed all data, and contributed in the preparation of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by MOEHRD Basic Research Promotion Fund (KRF-2005-003-E00265) and the BK21 Program of Ministry of Education, Republic of Korea.

References

  1. Graziano A, d'Aquino R, Tirino V, Desiderio V, Rossi A, Pirozzi G: The stem cell hypothesis in head and neck cancer.

    J Cell Biochem 2007. OpenURL

    DOI 10.1002/jcb.21436

  2. Reya T, Morrison SJ, Clarke MF, Weissman IL: Stem cells, cancer, and cancer stem cells.

    Nature 2001, 414:105-111. PubMed Abstract | Publisher Full Text OpenURL

  3. Dexter TM, Spooncer E: Growth and differentiation in the hemopoietic system.

    Annu Rev Cell Biol 1987, 3:423-441. PubMed Abstract | Publisher Full Text OpenURL

  4. Jones PH: Epithelial stem cells.

    Bioessays 1997, 19:683-690. PubMed Abstract | Publisher Full Text OpenURL

  5. Watt FM: Epidermal stem cells: markers, patterning and the control of stem cell fate.

    Philos Trans R Soc Lond B Biol Sci 1998, 353:831-837. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  6. Orkin SH: Diversification of haematopoietic stem cells to specific lineages.

    Nat Rev Genet 2000, 1:57-64. PubMed Abstract | Publisher Full Text OpenURL

  7. Fuchs E, Segre JA: Stem cells: a new lease on life.

    Cell 2000, 100:143-155. PubMed Abstract | Publisher Full Text OpenURL

  8. Clarke RB: Isolation and characterization of human mammary stem cells.

    Cell Prolif 2005, 38:375-386. PubMed Abstract | Publisher Full Text OpenURL

  9. Dean M, Fojo T, Bates S: Tumor stem cells and drug resistance.

    Nat Rev Cancer 2005, 5:275-84. PubMed Abstract | Publisher Full Text OpenURL

  10. Pan CX, Zhu W, Cheng L: Implications of cancer stem cells in the treatment of cancer.

    Future Oncol 2006, 2:723-731. PubMed Abstract | Publisher Full Text OpenURL

  11. Bonnet D, Dick JE: Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell.

    Nat Med 1997, 3:730-737. PubMed Abstract | Publisher Full Text OpenURL

  12. Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S, Crowley D, Bronson RT, Jacks T: Identification of bronchioalveolar stem cells in normal lung and lung cancer.

    Cell 2005, 121:811-813. PubMed Abstract | Publisher Full Text OpenURL

  13. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks PB: Identification of human brain tumor initiating cells.

    Nature 2004, 19:396-401. Publisher Full Text OpenURL

  14. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF: Prospective identification of tumorigenic breast cancer cells.

    Proc Natl Acad Sci USA 2003, 100:3983-3988. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  15. Al-Hajj M, Clarke MF: Self-renewal and solid tumor stem cells.

    Oncogene 2004, 23:7274-7282. PubMed Abstract | Publisher Full Text OpenURL

  16. Woodward WA, Chen MS, Behbod F, Rosen JM: On mammary stem cells.

    Cell Sci 2005, 118:3585-3594. Publisher Full Text OpenURL

  17. Moore KA, Lemischka IR: Stem cells and their niches.

    Science 2006, 311:1880-1885. PubMed Abstract | Publisher Full Text OpenURL

  18. Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC: Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.

    J Exp Med 1996, 183:1797-1806. PubMed Abstract | Publisher Full Text OpenURL

  19. Sumitra B, John DJ, Ani VD, Wallace BT, Charles K, Jackson J, Shantaram J, Iqbal A: Direct identification and enrichment of retinal stem cells/progenitors by hoechst dye efflux assay.

    Invest Ophthalmol Vis Sci 2003, 44:2764-2773. PubMed Abstract | Publisher Full Text OpenURL

  20. Jackson KA, Mi T, Goodell MA: Hematopoietic potential of stem cells isolated from murine skeletal muscle.

    Proc Natl Acad Sci USA 1999, 96:14482-14486. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  21. Hulspas R, Quesenberry PJ: Characterization of neurosphere cell phenotypes by flow cytometry.

    Cytometry 2000, 40:245-250. PubMed Abstract | Publisher Full Text OpenURL

  22. Asakura A, Rudnicki MA: Side population cells from diverse adult tissues are capable of in vitro hematopoietic differentiation.

    Exp Hematol 2002, 30:1339-1345. PubMed Abstract | Publisher Full Text OpenURL

  23. Lechner A, Leech CA, Abraham EJ, Nolan AL, Habener JF: Nestin-positive progenitor cells derived from adult human pancreatic islets of Langerhans contain side population (SP) cells defined by expression of the ABCG2 (BCRP1) ATP-binding cassette transporter.

    Biochem Biophys Res Commun 2002, 293:670-674. PubMed Abstract | Publisher Full Text OpenURL

  24. Ho MM, Ng AV, Lam S, Hung JY: Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells.

    Cancer Res 2007, 15:4827-4833. Publisher Full Text OpenURL

  25. Scharenberg CW, Harkey MA, Torok-Storb B: The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors.

    Blood 2002, 15:507-512. Publisher Full Text OpenURL

  26. Deng HB, Adikari M, Parekh HK, Simpkins H: Ubiquitous induction of resistance to platinum drugs in human ovarian, cervical, germ-cell and lung carcinoma tumor cells overexpressing isoforms 1 and 2 of dihydrodiol dehydrogenase.

    Cancer Chemother Pharmacol 2004, 54:301-307. PubMed Abstract | Publisher Full Text OpenURL

  27. HUGO (Human genome organization) [http://www.hugo-international.org/] webcite

  28. Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, Lagutina I, Grosveld GC, Osawa M, Nakauchi H, Sorrentino BP: The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype.

    Nat Med 2001, 7:1028-1034. PubMed Abstract | Publisher Full Text OpenURL

  29. Maliepaard M, Van Gastelen MA, De Jong LA, Pluim D, Van Waardenburg RC, Ruevekamp-Helmers MC, Floot BG, Schellens JH: Overexpression of the BCRP/MXR/ABCP gene in a topotecan-selected ovarian tumor cell line.

    Cancer Res 1999, 15:4559-4563. OpenURL

  30. Lou H, Dean M: Targeted therapy for cancer stem cells: the patched pathway and ABC transporters.

    Oncogene 2007, 26:1357-1360. PubMed Abstract | Publisher Full Text OpenURL

  31. Smithgall TE, Harvey RG, Penning TM: Oxidation of the trans-3,4-dihydrodiol metabolites of the potent carcinogen 7,12-dimethylbenz(a)anthracene and other benz(a)anthracene derivatives by 3 alpha-hydroxysteroid-dihydrodiol dehydrogenase: effects of methylsubstitution on velocity and stereochemical course of trans-dihydrodiol oxidation.

    Cancer Res 1988, 1:1227-1232. OpenURL

  32. Timmer-Bosscha H, Mulder NH, de Vries EG: Modulation of cis-diamminedichloroplatinum(II) resistance: a review.

    Br J Cancer 1992, 66:227-238. PubMed Abstract OpenURL

  33. Burczynski ME, Harvey RG, Penning TM: Expression and Characterization of Four Recombinant Human Dihydrodiol Dehydrogenase Isoforms: Oxidation of trans-7,8-Dihydroxy-7,8-dihydrobenzo[a]pyrene to the Activated o-Quinone Metabolite Benzo[a]pyrene-7,8-dione.

    Biochemistry 1998, 37:6781-6790. PubMed Abstract | Publisher Full Text OpenURL

  34. Rizner TL, Smuc T, Rupreht R, Sinkovec J, Penning TM: AKR1C1 and AKR1C3 may determine progesterone and estrogen ratios in endometrial cancer.

    Mol Cell Endocrinol 2006, 27:126-135. Publisher Full Text OpenURL

  35. Mukherjee K, Syed V, Ho SM: Estrogen-induced loss of progesterone receptor expression in normal and malignant ovarian surface epithelial cells.

    Oncogene 2005, 24:4388-4400. PubMed Abstract | Publisher Full Text OpenURL

  36. Bauman DR, Rudnick SI, Szewczuk LM, Jin Y, Gopishetty S, Penning TM: Development of Nonsteroidal Anti-inflammatory Drug Analogs and Steroid Carboxylates Selective for Human Aldo-Keto Reductase Isoforms: Potential Antineoplastic Agents That Work Independently of Cyclooxygenase Isozymes.

    Mol Pharmacol 2005, 67:60-68. PubMed Abstract | Publisher Full Text OpenURL

  37. Wang HW, Lin CP, Chiu JH, Chow KC, Kuo KT, Lin CS, Wang LS: Reversal of inflammation-associated dihydrodiol dehydrogenases (AKR1C1 and AKR1C2) overexpression and drug resistance in nonsmall cell lung cancer cells by wogonin and chrysin.

    Int J Cancer 2007, 120:2019-2027. PubMed Abstract | Publisher Full Text OpenURL

  38. Hsu NY, Ho HC, Chow KC, Lin TY, Shih CS, Wang LS, Tsai CM: Overexpression of dihydrodiol dehydrogenase as a prognostic marker of non-small cell lung cancer.

    Cancer Res 2001, 15:2727-2731. OpenURL

  39. Yoon SY, Kim JM, Oh JH, Jeon YJ, Lee DS, Kim JH, Choi JY, Ahn BM, Kim SS, Yoo HS, Kim TS, Kim NS: Gene expression profiling of human HBV- and/or HCV-associated hepatocellular carcinoma cells using expressed sequence tags.

    Int J Oncol 2006, 29:315-327. PubMed Abstract | Publisher Full Text OpenURL

  40. NCBI, GEO [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE994] webcite

  41. Mitsutake N, Iwao A, Nagai K, Namba H, Ohtsuru A, Saenko V, Yamashita S: Characterization of side population in thyroid cancer cell lines: cancer stem-like cells are enriched partly but not exclusively.

    Endocrinology 2007, 148:1797-1803. PubMed Abstract | Publisher Full Text OpenURL

  42. Spira A, Beane J, Shah V, Liu G, Schembri F, Yang X, Palma J, Brody JS: Effects of cigarette smoke on the human airway epithelial cell transcriptome.

    Proc Natl Acad Sci USA 2004, 101:10143-10148. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  43. GEO [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE1323] webcite

  44. Kao YR, Shih JY, Wen WC, Ko YP, Chen BM, Chan YL, Chu YW, Yang PC, Wu CW, Roffler SR: Tumor-associated antigen L6 and the invasion of human lung cancer cells.

    Clin Cancer Res 2003, 9:2807-2816. PubMed Abstract | Publisher Full Text OpenURL

  45. Kinsey M, Smith R, Lessnick SL: NR0B1 is required for the oncogenic phenotype mediated by EWS/FLI in Ewing's sarcoma.

    Mol Cancer Res 2006, 4:851-859. PubMed Abstract | Publisher Full Text OpenURL

Have something to say? Post a comment on this article!

Terms and Conditions Privacy statement Information for advertisers Jobs at BMC Contact us
© 1999-2009 BioMed Central Ltd unless otherwise stated. Part of Springer Science+Business Media.