Skip to main content

MUC1 gene overexpressed in breast cancer: structure and transcriptional activity of the MUC1 promoter and role of estrogen receptor alpha (ERα) in regulation of the MUC1 gene expression

Abstract

Background

The MUC1 gene encodes a mucin glycoprotein(s) which is basally expressed in most epithelial cells. In breast adenocarcinoma and a variety of epithelial tumors its transcription is dramatically upregulated. Of particular relevance to breast cancer, steroid hormones also stimulate the expression of the MUC1 gene. The MUC1 gene directs expression of several protein isoforms, which participate in many crucial cell processes. Although the MUC1 gene plays a critical role in cell physiology and pathology, little is known about its promoter organization and transcriptional regulation. The goal of this study was to provide insight into the structure and transcriptional activity of the MUC1 promoter.

Results

Using TRANSFAC and TSSG soft-ware programs the transcription factor binding sites of the MUC1 promoter were analyzed and a map of transcription cis-elements was constructed. The effect of different MUC1 promoter regions on MUC1 gene expression was monitored. Different regions of the MUC1 promoter were analyzed for their ability to control expression of specific MUC1 isoforms. Differences in the expression of human MUC1 gene transfected into mouse cells (heterologous artificial system) compared to human cells (homologous natural system) were observed. The role of estrogen on MUC1 isoform expression in human breast cancer cells, MCF-7 and T47D, was also analyzed. It was shown for the first time that synthesis of MUC1/SEC is dependent on estrogen whereas expression of MUC1/TM did not demonstrate such dependence. Moreover, the estrogen receptor alpha, ERα, could bind in vitro estrogen responsive cis-elements, EREs, that are present in the MUC1 promoter. The potential roles of different regions of the MUC1 promoter and ER in regulation of MUC1 gene expression are discussed.

Conclusion

Analysis of the structure and transcriptional activity of the MUC1 promoter performed in this study helps to better understand the mechanisms controlling transcription of the MUC1 gene. The role of different regions of the MUC1 promoter in expression of the MUC1 isoforms and possible function of ERα in this process has been established. The data obtained in this study may help in development of molecular modalities for controlled regulation of the MUC1 gene thus contributing to progress in breast cancer gene therapy.

Background

The MUC1 gene belongs to a family of genes encoding mucin glycoproteins [1]. MUC1 is normally expressed on the apical surface of mammary epithelial cells. However, in breast adenocarcinoma and a number of epithelial tumors, MUC1 is upregulated with aberrant expression over the entire cell surface [14]. This characteristic makes the MUC1 protein valuable as a marker in breast cancer diagnostics and prognosis [2]. In addition to epithelial cells, expression of MUC1 glycoprotein has been observed also in hematopoetic cells, T- and B-lymphocytes, hepatocytes, myocytes and nerve cells [5, 6].

Molecular studies have revealed several MUC1 protein isoforms: MUC1/TM, MUC1/SEC, MUC1/Y, MUC1/X and MUC1/Z [4, 7, 8]. The MUC1 isoforms demonstrate a diversity of properties and functions which may explain the crucial role of the MUC1 protein in many physiological and pathological processes. It participates in signal transduction, blastocyst implantation, epithelial cell morphogenesis, cellular adhesion, T-cell immunosuppression and matastases progression [9]. Expression of the MUC1/TM, MUC1/X, MUC1/Y and MUC1/Z is associated with the presence of malignancy, whereas expression of MUC1/SEC is observed mostly in non-malignant tissue [10].

The coordinated expression of multiple MUC1 isoforms in a wide spectrum of cells suggests a fine-tuning of mechanisms regulating MUC1 transcription in a cell- and tissue-specific manner. One of the essential steps of transcriptional regulation is binding of transcription factors to transcription cis-elements in promoter DNA. The combinatorial arrangement of cis-elements in a gene promoter is one of the important factors that determine gene transcription. For this reason, identification of cis-elements and their arrangement in a given promoter is of great importance and may provide clues to unravel potential mechanisms regulating transcription of a given gene.

The computer analysis of promoter DNA sequences is an appropriate method for identification of transcription cis-elements. Previously, we analyzed the content and composition of transcription cis-elements in the 3'-end 725 bp fragment of the MUC1 promoter [11]. In this relatively short fragment we found more than one hundred cis-elements demonstrating the high level of MUC1 promoter complexity both structurally and functionally. Nonetheless, these findings represented only a small portion of the cis- elements operating in the full length MUC1 promoter. One of the goals of this study was to further analyze the content and arrangement of transcription factor binding sites in the full 2872 bp MUC1 promoter and to construct a MUC1 cis- element map.

Many studies of transcriptional regulation have been performed by transient transfection. Usually, in such experiments, a recombinant plasmid containing a promoter (or part of it) obtained from a gene of a given type (human, for example) and coding region (test-gene) from a gene of another type (bacterial CAT-gene, luciferase gene) is used. This artificial construct is transfected into cells (mouse, for example) that naturally do not express the gene of interest. Analysis of endogenous genes in homologous systems is more biologically relevant than these artificial set-ups for several reasons. It is known that introns play important role in transcriptional regulation [12], however, in artificial systems they are excluded from this process. The results of transcription, as evaluated by RT-PCR, depend on the stability of nuclear RNA-transcripts that, in turn, is determined by the gene's 3'UTR [13]. It should be underscored that usage of transfection assays with a promoter separated from its exon-intron sequences and 3'UTR, may distort the natural mechanisms of transcriptional regulation of the given gene. The inadequacy of the described system for analysis of natural regulation of transcription becomes even more obvious when properties of transcription factors of different origins are taken into account. For instance, in certain conditions the affinity and binding specificity of mouse transcription factors for ligands and cis-elements may be different from those of corresponding human transcription factors or transcription factors of other non-relative species [14, 15]. This may lead to aberrant transcription of a human gene in mouse cells upon transient transfection. Therefore, for obtaining more objective information on the promoter activity and transcriptional regulation, it is important to study the expression of a gene both in transiently transfected heterologous cells and in cells in which the gene of interest is expressed endogenously. In this study, we investigated the roles of different regions of the MUC1 promoter in expression of human MUC1 isoforms using transient transfection. However, in addition to ectopic transfection assays we also investigated expression of the human MUC1 gene in human epithelial cells.

MUC1 expression is predominantly hormonally regulated [1620]. Although intensively studied [1618], the mechanisms of steroid regulation of MUC1 transcription are still obscure. Estrogen increases MUC1 expression [17], whereas the antiestrogen ICI 164,387 inhibits estradiol-stimulated MUC1 synthesis [19]. These results imply a specific effect of estrogen and suggest that nuclear estrogen receptor(s) are likely to be involved in MUC1 transcription [19]. However, in the mouse MUC1 promoter the estrogen receptor (ER) does not bind directly to estrogen receptor cis-element, ERE [18]. Among the cis- elements found in the 725 bp fragment of the human MUC1 promoter, we have detected several sites homologous to ERE [11]. In this study of the full MUC1 promoter, we identified an additional ERE. We analyzed the role of estrogen in regulation of the MUC1 transcription in human epithelial cells in vivo and have investigated the potential of ER to bind cis-ERE of the human MUC1 promoter in vitro. We showed for the first time that estrogen differentially regulates expression of the MUC1 isoform specific mRNAs in human breast cancer cells: it activates expression of the MUC1/SEC isoform but does not affect expression of the MUC1/TM mRNA. By electrophoresis mobility shift assay (EMSA) we were able to demonstrate that ERα present in T47D cell lysate could directly bind to MUC1 promoter EREs, thus supporting the hypothesis that regulation of the MUC1 expression by estrogen may be realized by ER binding to EREs present in the MUC1 promoter.

Results

Structural analysis of the MUC1 promoter

Using computer analysis of the 2872 bp MUC1 promoter sequence, we identified multiple transcription factor specific cis-elements (674 sites in the sense strand and 452 site in the opposite strand) and constructed a map that shows the arrangement of these elements in the MUC1 promoter ("Additional files 1, 2, 3"). The level of homology between the MUC1 cis-elements in our study and corresponding consensus sequences was 0.75–1.0. This facilitated isolation of discrete cis-elements that were highly homologous to consensus sequences, but demonstrated a definite degree of freedom in flanking regions. The analysis of these cis-elements revealed several important characteristics of the MUC1 promoter:

  1. 1)

    The numerous cis-elements found in the MUC1 promoter potentially afford gene expression in a wide spectrum of cells. Among these elements were ubiquitous eukaryotic cis-elements as well as mammary, muscle, liver, hematopoietic and immune cell specific elements. Additionally, the MUC1 promoter contained cis-elements found in viral promoters. Some of the elements (Ikarus-2, AML-1 or YY1) were represented in the promoter by multiple copies, while the others (NF1-tkII or Evi F) were unique and appeared in the MUC1 promoter only once ("Additional files 1, 2, 3").

  2. 2)

    Although most eukaryotic promoters usually carry a single RNA-pol II initiation box (either TATA-box, GC-box or Initiator) [2123], the MUC1 promoter carried all three motifs. Moreover, the MUC1 promoter contained numerous CAP-sites that could function as putative transcription start sites (TSS). Some of the functionally active TSS have been experimentally verified [11].

  3. 3)

    One important feature of the MUC1 promoter was an extensive overlapping and clustering of cis- elements. Overlapping of cis- elements could facilitate competition between different transcription factors (see "Additional files 1, 2, 3"). Competing factors may be agonistic or antagonistic, either activating or repressing transcription. For example, at position -2785/-2775 the binding site for YY1 repressor overlaps the binding site specific for transcriptional activator Pu, while in another cluster (-1432/-1407), this repressor may compete both with a repressor (Gfi-1 immunospecific repressor) and with three activators (immunospecific activator Ikarus, hepatospecific activator SREBP1 and general activator protein AP1). Thus, different arrangements of cis-elements in the MUC1 promoter provide conditions for competition of multiple cell- and tissue-specific transcription factors which, in turn, might determine cell and tissue specificity of MUC1 gene transcription. The construction of the cis- element map was the first step in the programmed study of the MUC1 transcriptional regulation. The map has been employed to design functional analysis experiments of transcription factors and their potential to compete for corresponding cis- elements.

Analysis of MUC1 promoter activity by transient transfection assays

In our previous investigations [11] we employed CAT assays to evaluate the activity of a truncated human MUC1 promoter. In this study, we examined the role of different domains within the full-length MUC1 promoter in expression of MUC1 gene. The plasmid, Dpr, based on the ppolyII backbone was constructed to contain the full length (-2872/+1) human MUC1 promoter and genomic sequence of the human MUC1 gene including exons and introns. Using this plasmid we generated three sequential deletions from the 5'-end of the MUC1 promoter: pDprΔ2154 which lacks 2154 base pairs of promoter; pDprΔ2446 and pDprΔ2839 carrying only 426 and 33 residual nucleotides of the promoter sequence, respectively. These plasmids were used in transient transfection assays (Fig. 1A).

Figure 1
figure 1

Expression of the MUC1 isoform specific mRNA in mouse DA3 cells transfected with plasmids pDpr, pDprΔ2154, pDprΔ2446, pDprΔ2839 and ppolyIII. DA3 cells were transfected with plasmid DNA. Cells transfected with ppolyIII were used as negative controls. DA3 cells stably transfected with MUC1/SEC, MUC1/TM and MUC1/Y cDNA were used as positive control. Total RNA was extracted 48 hrs after transfection and cDNA was synthesized. PCR amplification of MUC1 isoform specific fragments were performed using isoform specific primers. PCR products were separated by electrophoresis on 1.2% agarose gel and stained with ethidium bromide. A – Schematic structure of the pDpr, pDprΔ2154, pDprΔ2446, pDprΔ2839 plasmids and the table of the MUC1/SEC, MUC1/TM and MUC1/Y mRNA expression in transfected DA3 cells. B – RT-PCR of the MUC1 isoform specific RNA extracted from DA3 cells transiently transfected with indicated plasmids. Lane M-DNA marker; lanes 1, 4, 7, 10 and 13 (negative control) – PCR performed with MUC1/SEC specific primers; lanes 2, 5, 8, 11 and 14 (negative control) – PCR performed with MUC1/TM specific primers; lanes 3, 6, 9, 12 and 15 (negative control) – PCR performed with MUC1/Y specific primers. Positive control: DA3 cells stably transfected with MUC1 isoform specific cDNA. Lane SEC – cells expressed MUC1/SEC; lane TM – cells expressed MUC1/TM and lane Y – cells expressed MUC1/Y RNAs.

In mouse breast carcinoma DA3 cells transiently transfected with plasmid Dpr, MUC1/SEC was the only human MUC1 isoform observed (Fig 1B, lane – 1). When DprΔ2154 plasmid was expressed in mouse cells, the MUC1/TM could be detected in addition to MUC1/SEC mRNA (Fig. 1B, lanes – 4 and 5). However, the level of MUC1/TM mRNA expression was less than the expression of MUC1/SEC mRNA. Interestingly, when the plasmid DprΔ2446 that lacks an additional 292 nucleotides of the MUC1 promoter was expressed into DA3 cells, the mRNA levels of MUC1/TM dramatically increased (Fig. 1B, lane – 8) whereas the expression of MUC1/SEC isoform mRNA was much less pronounced (Fig. 1B, lane – 7). In cells over-expressing plasmid DprΔ2839, only MUC1/SEC mRNA could be detected (Fig. 1B, lane – 10). These results suggest that expression of MUC1/SEC and MUC1/TM isoform specific mRNAs in our experimental system might be controlled by different regions of the MUC1 promoter. No expression of MUC1/Y mRNA was observed in any of our transfection assays (Fig. 1B, lanes – 3, 6, 9 and 12). The reason for this is presently being studied by using different transfection and PCR parameters and changing gel running and exposure conditions.

Expression of MUC1 isoform mRNAs in human breast cancer cell lines and the role of estrogen in transcriptional regulation of the MUC1 gene in vivo

The next step in our investigation was study of the MUC1 transcription in natural conditions. For this purpose we evaluated expression of the MUC1 isoform specific mRNA in human breast epithelial cells T47D, MCF7 and MDA-MB-231. We also used these cells for studying the role of estrogen and estrogen receptors (ER) in MUC1 transcription. In non-treated, ER-negative T47D (T47D, clone 8) and MDA-MB-231 cells, only MUC1/TM mRNA could be detected (Fig 2, lanes – 14 and 17, respectively). As expected, treatment of these cells with estrogen did not change the pattern of the MUC1 gene expression (data not shown). When ER-positive T47D cells (T47D, clone 10) were grown without estrogen also they expressed only MUC1/TM mRNA (Fig. 2, lane – 8). However, treatment of these cells with estrogen activated transcription of the MUC1/SEC mRNA and MUC1/Y mRNAs although the later one was expressed much less (Fig. 2, lanes – 10 and 12, respectivelly). These results imply that estrogen has a differential effect on the expression of MUC1 isoforms. Whereas the expression of MUC1/TM does not depend on estrogen, MUC1/SEC and probably MUC1/Y isoforms are expressed in an estrogen-dependent manner. In untreated MCF7 cells, both the MUC1/SEC and MUC1/TM mRNA are clearly expressed (Fig. 2, lanes – 1 and 2) but MUC1/Y mRNA was hardly detected (Fig.2, lane – 3). When MCF-7 cells were treated with estrogen, the expression of MUC1/SEC and MUC1/Y mRNAs increased (Fig. 2, lanes 4–6).

Figure 2
figure 2

Expression of the MUC1 isoform specific mRNA in human mammary epithelial cells detected by RT-PCR. Total RNA from human MCF-7, T47D and MDA-231 cells and RNA from mouse DA3 cells stably transfected with MUC1/SEC (lane – SEC), MUC1/TM (lane – TM) and MUC1/Y (lane – Y) cDNA (positive controls) were extracted and RT-PCR amplification of the MUC1 isoform specific fragments were performed. Lanes 1, 4, 7, 10, 13, 16 and SEC – PCR performed with MUC1/SEC specific primers; lanes 2, 5, 8, 11, 14, 17 and TM – PCR performed with MUC1/TM specific primers; lane 3, 6, 9, 12, 15, 18 and Y – PCR performed with MUC1/Y specific primers.

To clarify the role of estrogen and estrogen receptors (ER) in transcriptional regulation of the human MUC1 gene, experiments with antiestrogen 4-hydroxytamoxifen (4-OHT) were performed. 4-OHT competes with estrogen for binding to ER thus disrupting the signal transduction originating from estrogen. Fig. 3 shows that estrogen increased and 4-OHT somewhat inhibited the expression of MUC1/SEC mRNA in a dose dependent manner in both T47D and MCF7 cells (Fig. 3, lanes 2–4 and 5–7, respectively). MUC1/TM mRNA expression did not respond to these agents. Expression of MUC1/Y mRNA was not sensitive to low concentration (0.1 nM and 1 nM of estrogen (Fig. 3, lanes 2 and 3) but was increased by high concentration (10 nM) of hormone in both cell lines (Fig. 3, lane 4). In contrast to MUC1/SEC, expression of MUC1/Y was not inhibited by 4-OHT (Fig. 3, lanes 5 – 7).

Figure 3
figure 3

Effect of estrogen and 4-hydroxytamoxifen (4-OHT) on expression of MUC1 isoform specific mRNA in T47D and MCF7 cells analyzed by RT-PCR. Human T47D (clone 10) and MCF7 cells were cultured in DMEM medium with or without estrogen and 4-OHT supplements as described in "Materials and Methods". Total RNA was extracted and MUC1 isoform specific RT-PCR was performed. Lane M-DNA marker; lane 1 – cells grown in the medium without estrogen; lanes 2, 3 and 4 – cells grown with 0.1 nM, 1 nM and 10 nM estrogen, respectively; lanes 5, 6 and 7 – cells grown with 10 nM estrogen and with 10 nM, 100 nM and 1 μM 4-OHT supplements, respectively.

Our results document the differential effect of estrogen and 4-OHT on the expression of the MUC1 isoform mRNAs. Since the above experiments suggest an involvement of ER in MUC1 transcriptional regulation at least of some of its isoforms, next we wished to analyze the binding of human ERs to the MUC1 promoter cis-estrogen response element (cis-ERE).

Binding of ERα to cis-ERE in the MUC1 promoter

To investigate the potential binding of ER to the MUC1 cis-ERE we employed electrophoresis mobility shift assays (EMSAs). It has previously been shown by Western blot analysis that ERα is the main type of estrogen receptor expressed in T47D cells [24]. We confirmed this observation by RT-PCR (data not shown). Taking this into account, we concentrated our efforts on studying the ability of the MUC1 EREs to bind ERα.

Nuclear lysate of estrogen-treated T47D cells (clone 10, ER+) served as a source of ERα. The oligonucleotides utilized in this study were homologous to the six cis-EREs found in the MUC1 promoter by our bioinformatics search. The oligonucleotide Vit-ERE originating from the vitellogenin gene and consisting of a canonical palindrome ERE (GGTCANNN TGACC) [25] was used as a positive control. It contains one direct and one inverted repeats of consensus sequence (GGTCA) separated by three intermediate nucleotides. In the MUC1 promoter, although we did not locate a classical palindrome ERE, a reminiscent cis-element sequence (GGACCN CGACC) structurally similar to Vit-ERE was identified. This cis-element, called "putative" ERE-6, was located at the position -349/-339. Five other half (1/2 of the core sequence) direct (GGTCA) or inverted (TGACC) sequences were found at positions -2748/-2744 (ERE-1), -1174/-1170 (ERE-2), -745/-741 (ERE-3), -384/-380 (ERE-4) and -364/-360 (ERE-5) (see "Additional files 1, 2, 3").

When Vit-ERE was incubated with T47D nuclear lysate, three main complexes, C1, C2 and C3, were detected (Fig. 4A, lanes 19, 21 and 25). The complex C1 had the highest gel mobility and apparently represented the simplest nucleoprotein complex composed of ERα and Vit-ERE oligonucleotide. The complexes C2 and C3, in addition to components present in the complex C1, might contain also ER-specific cofactors [26].

Figure 4
figure 4

ERα binding to EREs detected in the MUC1 promoter. The EMSA of the complexes (C1, C2 and C3) developed by ERα from T47D nuclear lysate and 32P-labeled oligonucleotides containing the MUC1 promoter EREs (for details see "Materials and Methods"). A: Binding of ERα to 32P-labeled oligonucleotides ERE1, ERE2, ERE3, ERE4 and ERE5, containing 1/2 consensus core sequence of the classical ERE, and to palindrome like ERE (putative ERE-6 and Vit ERE). Lanes 1, 3, 5, 7, 10, 12, 19 and 26 – complexes developed in absence of anti-ERα Ab; lanes 2, 4, 6, 8, 11, 13, 20 and 27 – partial or complete inhibition of complex formation by anti-ERα Ab; lanes 14, 21 and 28 – binding of ERα to 32P-ERE2, Vit-ERE and ERE6, respectively, in the presence of "cold" Oct1 oligonucleotide; lanes 15–18 – binding of ERα to 32P-ERE2 in presence of decreasing amount of the "cold" ERE2; lanes 22–25 – binding of ERα to 32P-Vit ERE in presence of decreasing amount of the "cold" Vit ERE (* indicates an intermediate complex developed when binding reaction was kept on ice); lanes 29–32 – binding of ERα to 32P-ERE6 in presence of decreasing amount of the "cold" ERE6. B: Effects of anti-ERα Ab and normal rabbit serum (NRS) on ERα binding to MUC1 specific and mutated EREs. Lanes 1, 6 and 11 – binding of ERα in absence of anti-ERα Ab; lanes 2, 7 and 12 – partial or complete inhibition of binding complexes by anti-ERα Ab; lanes 3, 8 and 13 – binding of ERα in presence of NRS; lanes 4, 9 and 14 – binding of ERα to mutated ERE in absence of anti-ERα Ab; lanes 5, 10 and 15 – binding of ERα to mutated ERE in presence of anti-ERα Ab.

In our assays, all MUC1 promoter EREs could bind ERα (Fig. 4A, lanes – 1, 3, 5, 7, 10 and 12). However, the complexes developed with different ERE had different gel mobilities. The most prominent binding was observed with "putative" ERE-6 and ERE-2 (Fig. 4A, lanes – 10 and 12, respectively), while the affinity of ERE-1, ERE-3, ERE-4 or ERE-5 to ERα was less apparent (Fig. 4A, lanes – 1, 3, 5, and 7). The complexes containing the ERE-1, -3, -4 and -5 oligonucleotides migrated as a faint single band (Fig. 4A, lanes – 1, 3, 5, and 7) corresponding to complex "C1". The ERE-2 formed two complexes, C1 and far predominant C2, (Fig. 4A, lane – 12). The "putative" ERE-6 also revealed two types of complexes equivalent to C1 and C3 (Fig. 4A, lanes 10, 26 and 28). The complexes C1, C2 and C3 were observed usually when the binding reaction was kept at room temperature. However, if the binding reaction was performed on ice, an intermediate complex(es) appeared (Fig. 4A, lane 24, band*).

The specificity of ERα binding to the MUC1 promoter EREs was validated by the ability of anti-ERα antibodies to partially or completely inhibit binding ERE (Fig. 4A, lanes – 2, 4, 6, 8, 11 and 13; Fig. 4B, lanes – 2, 7 and 12). Normal rabbit serum failed to inhibit the binding of ERα (Fig. 4B, lanes – 3, 8 and 13). The mutated ERE sequences did not bind ERα (Fig. 4B, lanes – 4, 9 and 14). The electrophoretic profiles of the products obtained in reaction with mutated oligonucleotides could not be changed by anti-ERα antibodies (Fig. 4B, lanes – 5, 10 and 15). Moreover, corresponding "cold" ERE-oligonucleotides (Fig 4A, lanes 15–18, 22–25 and 29–32) but not irrelevant oligonucleotide OCT-1 (Fig 4A, lanes 14, 21 and 28) successfully competed-out binding of ERα to specific ERE-containing oligonucleotides. In conclusion, our results demonstrate the ability of the MUC1 promoter EREs to specifically bind ERα in vitro. Further experiments will be needed to study the interaction between ERα and MUC1 specific EREs in vivo.

Discussion

The expression of multiple isoforms of the MUC1 gene [2, 4, 7, 9] in a variety of cell types [26] and the active role of the gene in different physiological processes [9] suggest a fine-tuned transcriptional regulation. Some specific questions that we have addressed in this study include: 1) Does the MUC1 promoter regulate differential expression of isoform specific mRNAs? 2) Is the expression of human MUC1 gene transfected into heterologous (mouse) cells relevant to its endogenous expression in homologous (human) cells? 3) How does estrogen regulate MUC1 transcription? Some of these questions have been answered in this study, others are still issues for our ongoing investigations.

Numerous overlapping and densely distributed cis-elements that potentially could bind a multitude of transcription factors demonstrate the structural and functional complexity of the MUC1 promoter. Further evidence of the MUC1 promoter complexity is the presence of several elements that participate in the development of RNA-Pol II initiation complexes (TATA-boxes, GC-boxes and initiators) and multiple transcription start sites (CAP-sites).

Usually, eukaryotic promoters that regulate transcription by RNA polymerase II belong to one of four types: 1) TATA-box-containing promoter (facultative genes) [21]; 2) GC-box-containing promoter (housekeeping genes) [22]; 3) Initiator-containing promoter (first described in genes expressed in B-cells) [23]; 4) "Dual" promoter that have both TATA- and GC-elements and drive both TATA- and GC-boxes specific transcription (found in cathepsin D and methallotheonin genes) [27]. The MUC1 promoter demonstrates properties characteristic for promoters of different types. It contains several TATA- and GC-boxes and a number of initiators (see "Additional files 1, 2, 3"). It contains multiple cis-elements that potentially transcribe the MUC1 gene in many different cell types and tissues and cis-elements specific for viral promoters [2, 3, 5, 2830]. These peculiarities of the MUC1 promoter allow us to classify it as a "mixed polypotent promoter". We believe that studies of eukaryotic transcription will reveal increasing number of genes with this type of promoter.

Our bioinformatic study of the MUC1 promoter resulted in construction of the MUC1 cis-element map. This map has several advantages. Using the map, one may design a functional analysis of transcription factors potentially competing for overlapping cis-elements in the MUC1 promoter. It also allows prediction of cells in which the MUC1 gene might be expressed. Based on the content of the MUC1 cis-elements, we predicted expression of the MUC1 gene in lymphoid and muscle cells that had been thought to be MUC1 non-producing cells. Subsequently, the MUC1 expression in these cells was confirmed experimentally [5]. Obviously, in a single study it is impossible to evaluate functional activities of all cis-elements detected in the MUC1 promoter. Nevertheless, several cis-elements that were identified by our bioinformatic approach (MZF-1, Sp1 and STAT) have been already found active in transcriptional regulation of the MUC1 gene in vivo [2830].

Transient transfection of plasmids that have different deletions within the promoter DNA can identify promoter regions necessary for the expression of specific mRNA isoforms. We combined this approach with our bioinformatics information to experimentally characterize the MUC1 promoter activity. In our study, the Dpr plasmid that contained a full-length MUC1 promoter supported expression only of the MUC1/SEC isoform (Fig. 1B, lane – 1). In contrast, the plasmid DprΔ2154 lacking a ~2 kb fragment deleted from the 5'-end of the promoter demonstrated higher activity and supported expression of both MUC1/SEC and MUC1/TM mRNA (Fig. 1B, lanes – 4 and 5, respectively), indicating that within the deleted fragment are transcriptional repressor binding sites. Our cis-element map supports this hypothesis, since the deleted fragment of the MUC1 promoter (-2872/-718) contains multiple binding sites for transcriptional repressors: 9 sites for δEF1-repressor (-2180/-2170, -1546/-1536, -1522/-1512, -1486/-1476, -1462/-1452, -1418/-1408, -1175/-1165, -1029/-1019 and -1008/-998), 7 sites specific for the Gfi-1 repressor (-2627/-2515, -2589/-2574, -2530/-2515, -1738/-1723, -1435/-1420, -1306/-1291 and -1141/-1126), 5 sites specific for YY1-repressor (-2786/-2776, -2772/-2762, -1428/-1418, -1395/-1385 and 1203-1193) and a single ELP repressor binding site (-1172/-1165) (see "Additional files 1, 2").

Plasmid DprΔ2446, lacking an additional 292 bp, elevates MUC1/TM expression but leads to a decrease in the expression of the MUC1/SEC mRNA compared to DprΔ2154 (Fig 1B, lanes – 7 and 8). These observations suggest that the deleted 292 bp fragment might contain both additional sites for MUC1/TM mRNA repressors as well as sites important for MUC1/SEC expression. Indeed, as the map shows, the deleted fragment contains cis- elements specific for two repressors, YY1- (-670/-660) and δEF1- (-472/-462), in addition to several cis-elements specific for mammary epithelial cell activators: CTF/NF, ESE1, MAF, MGF, MP4 and RME [3134] (see "Additional file 3").

According to results obtained with the DprΔ2839 plasmid, a minimal set of transcription elements (one TATA-box, one CAP-site and several cis-elements specific for transcriptional activators RCE, SRE and ETF-RE) (see "Additional file 3") is sufficient for expression of MUC1/SEC isoform (Fig. 1B, lane – 10). Transcriptional activity of the minimal MUC1 promoter has been observed in transfection studies [35, 36]. Notably, two very different plasmids, one of which contains the full MUC1 promoter (Dpr) and the other which contains only a minimal promoter sequence (DprΔ2839), drive similar expression of the MUC1/SEC isoform. It appears that in our experimental conditions, the positive and negative effects of the cis-elements in the full promoter seem to balance-out each other resulting in expression of MUC1/SEC similar to that of the minimal promoter.

The results demonstrating higher activity of the truncated promoter (DprΔ2154, DprΔ2446) compared to the full length MUC1 promoter (Dpr) are not surprising. Earlier, Kovaric et al [36] showed that expression of the CAT-test gene driven by the full length MUC1 promoter was almost half than that directed by 743 bp promoter fragment. Abe and Kufe [35] also observed higher CAT activity when the test-gene was driven by a smaller promoter fragment (-686/+33) than by a larger one (-1656/+33). Moreover, according to these authors, the 114 bp fragment of the MUC1 promoter located between -598 and -485 bp demonstrated the highest CAT gene expression. Superimposition of the promoter fragments analyzed in these studies and our MUC1 cis- element map leads to similar schematics of activating and repressing regions.

One of the issues addressed in our research was whether the expression of the human MUC1 gene transfected into heterologous (mouse) cells is relevant to its endogenous expression in homologous (human) cells. The results described in this study showed that in our experimental conditions, the patterns of the MUC1 gene expression in both cell systems were different. In mouse cells, human MUC1 gene (Dpr plasmid) directed expression of the MUC1/SEC isoform, whereas in human cells, the predominant mRNA was MUC1/TM. In transfected mouse DA3 cells, we could not detect human MUC1/Y isoform, whereas in human T47D and MCF7 cells this isoform was observed. The basis for such differential expression is presently being studied.

One of the important issues in regulation of MUC1 expression is the role of estrogen and estrogen receptors. Several studies have showed that the MUC1 gene positively responds to estrogen [1619]. However, in our study, we observed that not all MUC1 isoforms responded to estrogen in the same manner. The MUC1/SEC mRNA was expressed in T47D cells (ER+ clone 10) only after treatment with estrogen. In contrast to T47D cells, in ER-positive MCF7 cells, expression of the MUC1/SEC mRNA was observed in the absence of estrogen, although, similarly to T47D cells, estrogen increased and 4-OHT decreased its expression. The MUC1/TM mRNA could be expressed both in T47D estrogen receptor positive cells (clone 10) and estrogen receptor negative cells (clone 8) as well as in MCF7 cells. Moreover, this expression was not affected by 4-OHT. The dependence of the MUC1/Y isoform expression on estrogen and ER was not clear cut. On one hand, we observed some increase in MUC1/Y expression in T47D and MCF7 cells after estrogen treatment but on the other hand, 4-OHT did not inhibit its expression. Further experiments will be needed to clarify this matter.

The above data suggest that the expression of MUC1 isoforms in MCF7 cells somehow differs from their expression in T47D cells. Perhaps relevant to our observations is that MCF7 and T47D cells express different levels of steroid receptors. In MCF7 cells, ER is expressed at much higher levels than progesterone receptors (PR), whereas in T47D cells, the expression of PR is higher than that of ER [37, 38]. Since estrogen regulates the transcription of the ER gene [39], it appears that T47D cells may require exogenous supplements of estrogen to activate expression of the ER gene. In contrast, the endogenous expression levels of estrogen receptors in MCF7 cells might be high enough to support expression of the MUC1/SEC isoform. In accordance with our results, Hurd et al [40] observed expression of hyperphosphorylated retinoblastoma protein (ppRB) in MCF7 but not in T47D cells when cells incubated without estrogen. A gradual increase of its expression after treatment with estrogen was observed in MCF7 cells in time-dependent manner. In T47D cells, longer estrogen treatment was necessary to detect ppRB than in MCF7 cells.

Our data demonstrating the responsiveness of the MUC1/SEC isoform expression in human epithelial cells to inhibitory effects of 4-OHT are in agreement with observations that the expression of MUC1 gene in human adenocarcinoma cells is also sensitive to antiestrogens [41, 42]. These data suggest that, in human cells, estrogen may regulate the MUC1 gene transcription by interaction with ER directing them to cis- ERE in MUC1 promoter. The results obtained by us with EMSA using T47D cell lysates support this hypothesis. However, they are in contradiction with the observations made in a mouse system. Studying the role of ER in transcriptional regulation of the mouse Muc1 gene, Zhou et al [18] concluded that ER did not directly bind to the cis- ERE of the murine Muc1 promoter. We found that all cis-ERE detected in the human MUC1 promoter could form complexes with human ERα in vitro. Several factors may explain this discrepancy. First, different cis-EREs were used in both studies. Although human and mouse MUC1 promoters have high degree of homology, their cis-EREs demonstrate pronounced diversity. We have analyzed the mouse Muc1 and human MUC1 promoter sequences and found that each promoter contains six cis-EREs. Comparison of these elements revealed both homology and differences in their sequences. Second, Zhou et al [18] analyzed binding of estrogen receptors that have been in vitro translated, whereas in our binding assays we used ERα endogenously synthesized in T47D cells that express human MUC1 gene.

It should be noted, that, although all MUC1 cis-EREs bound ERα, the properties of the complexes developed by different cis-EREs were different. Several cis-EREs, (ERE1, ERE3, ERE4 and ERE5) containing only half of the classical palindrome sequence produced a weak, fast migrating complex with ERα. Interestingly, ERE2, which also contains only half of the ERE palindrome sequence, developed two complexes that at least partially correspond to those observed with classical ERE from the vitellogenin gene and with "putative" ERE-6 of the MUC1 gene. The different electrophoretic mobility of the complexes might be explained by content of ER-cofactors in the complexes. It is not clear why oligonucleotides that have identical or very similar ERE core sequences recruit different cofactors to ER-containing complexes, however, the flanking sequences may play a crucial role in this process [43]. Importantly, all complexes developed with tested cis-ERE contained ERα since the binding of ERα was specific and could be inhibited by antibodies developed against the DNA-binding domain of human ERα.

Whereas our in vitro studies clearly showed that physical binding of ERα with cis- EREs of the MUC1 promoter occurs, definitive in vivo binding still remains to be proven. Orientation of ERE within the synthetic oligonucleotides appears not to be important for in vitro binding, but orientation and distribution of EREs among cis-elements within promoter, are presumably crucial for proper in vivo binding [4446]. A special approach will be needed to study this issue. In the MUC1 promoter, two estrogen responsive elements (ERE-1 and the "putative" ERE-6), have direct sequence orientation while others (ERE-2, ERE-3, ERE-4 and ERE-5) have opposite orientation. Three elements (ERE-1, ERE-2 and ERE-3) are located relatively distant from the active TATA-box and from each other. Three others (ERE-4, ERE-5 and the "putative" ERE-6) are located in close proximity to each other between nucleotides -389 and -337 (see "Additional files 1, 2, 3") and may function as an estrogen responsive unit [47, 48].

Very few mRNAs that are known to be directly regulated by estrogen in mammary epithelial cells are actually induced via canonical EREs [49]. In fact, most estrogen-responsive genes identified to date contain one or more imperfect EREs or multiple copies of an ERE half-site rather than the classical ERE [50, 51]. The MUC1 cis-EREs also are not absolutely identical to the consensus sequence. Although the affinity of the estrogen receptor for the classical ERE is higher than for imperfect ERE-like sequences, most of the imperfect EREs bind ER [52]. The MUC1 cis-EREs, although imperfect, also bound ER in vitro. It is becoming clear that EREs function as allosteric modulators of ER conformation [53, 54]. The conformational changes in ER induced by individual ERE sequences lead to specific association of the receptor with other transcription factors and assist in differential transcription of estrogen-responsive genes [54, 55]. In light of these data, the imperfect MUC1 cis-EREs might be significant, perhaps by differential usage of ERE in diverse cells recruiting distinct cofactors for the MUC1 expression.

We have discussed the possible involvement of ER and MUC1 EREs in regulation of the MUC1 gene transcription. However, it is known that ER may regulate gene transcription also by interaction with other transcription factors (STAT, AP1, EGFR or NFkB) without direct binding to ERE [56]. Further studies are needed to understand the process of MUC1 transcription in vivo and to elucidate the mechanism by which estrogen activates transcription of the MUC1 gene.

Although our study revealed some new and important features of the MUC1 promoter cis-element content and structure, the precise mechanisms by which these cis-sites are involved in the regulation of MUC1 expression have not been fully elucidated. On one hand, elements within the promoter could determine usage of different transcription start sites specific for individual MUC1 isoforms. The presence of multiple CAP-sites in the MUC1 promoter together with previously documented multiple transcription start sites of the MUC1 gene in T47D cells [11] support this hypothesis. On the other hand, the promoter cis-elements might be involved in regulating of alternative splicing of a single pre-mRNA common to all MUC1 isoforms. A growing body of evidence suggests that transcription and splicing are highly coordinated processes both at the structural and functional levels [5761]. For instance, it has been shown that mutations introduced into promoter cis-elements could change the alternative splicing patterns [58]. Moreover, the RNA pol II large subunit physically associates with spliceosomes and the SR proteins that regulate alternative splicing act through specific promoter occupation [62].

In light of these data, we suggest that cis-elements of the MUC1 promoter may be involved in mechanisms that regulate both transcription and splicing of the MUC1 pre-mRNAs. In this study, we used total RNA extracted from transfected cells. However, for a better understanding of the role of the MUC1 promoter in transcription and splicing of MUC1 isoforms, an additional study of the 5'-ends of nuclear pre-mRNA is needed. Additionally, the effect of different mutations within cis-sites of the MUC1 promoter on isoform expression could be more thoroughly dissected. These experiments are currently in progress.

Conclusion

In this study several important findings have been revealed. First, transcription cis-elements of the MUC1 promoter have been identified and the map of these elements has been constructed. The advantage of such a map is that it not only shows the content of the promoter cis-elements but exemplifies the transcription factors potentially competing for specific binding sites. Second, we established that different regions of the MUC1 promoter may control expression of different MUC1 isoform RNAs. We also observed differential expression patterns of the human MUC1 gene in heterologous (mouse) and homologous (human) cells. Third, we showed, for the first time, that estrogen can differentially regulate the expression of some MUC1 isoforms. For instance, estrogen activated expression of MUC1/SEC, but not MUC1/TM isoform in human breast cancer epithelial cells. Fourth, we found six cis-ERE in the MUC1 promoter and showed that they can bind ERα in vitro. Our findings may help to develop molecular modalities for controlled regulation of the MUC1 gene expression and thus may contribute to progress in molecular-based breast cancer therapy.

Methods

Computer analysis of potential transcription cis-elements

The computer analysis of the potential transcription cis-elements of the MUC1 promoter has been performed by using the TRANSFAC (MatInspector V2.2) and TSSG databases of transcription factors and their DNA binding sites [63, 64]. The 2.9 kb MUC1 promoter sequence was obtained from the GENE Bank NCBI: accession #-X69118. For construction of the MUC1 promoter cis-element map we used mainly those cis-elements whose sequence homology with corresponding consensus sequences was significantly high (0.75–1.0).

Cells

Human breast cancer cell lines MCF-7, T47D and MDA-231 and mouse breast cancer DA3 cells were cultured in full DMEM medium with 10% foetal calf serum (FCS), penicillin (100 u/ml), streptomycin (100 μg/ml) at 37°C in 5% CO2. One week before estrogen treatment, cells were transferred to phenol red-free DMEM medium containing antibiotics and 5% charcoal-treated FCS. The concentration of FCS was reduced to 1% one day before adding of 0.1–10 nM 17β-estradiol (E2) only or in combination with 10 nM – 1 μM 4-hydroxytamoxifen (4-OHT) (Sigma). Cells were incubated for 24 hours and then were harvested for RNA preparation.

Plasmids

The plasmid Dpr (pDpr) containing the human MUC1 full-length promoter and MUC1 coding sequence was constructed on a polyIII plasmid backbone [65]. The genomic MUC1 sequence was inserted into ppolyIII at the Eco RI site. The recombinant plasmid was then digested with restriction enzyme Pvu I generating two fragments of 6946 bp and 666 bp. The bigger fragment contained a part of ppolyIII, the full MUC1 promoter sequence (2872 bp) and all MUC1 exons and introns except for a part of cytoplasmic domain coding DNA. This DNA fragment together with 150 bp SV40 polyA sequence and 600 bp of the ppolyIII was isolated from the pCL642/MUC1/TM by Pvu I digestion [11]. The obtained Pvu I/Pvu I 870 bp fragment was ligated with 6946 bp PvuI/Pvu I fragment resulting in generation of pDpr. This plasmid contained the full-length promoter and the full coding region of the MUC1 gene. It was used for generation of deletions in the promoter region (Fig. 1A). The first deletion mutant of the MUC1 promoter was constructed by excision of 2154 bp promoter region from the pDpr by Sac I digestion followed by self-ligation of the rest of the pDpr. The resultant plasmid, pDprΔ2154, lacks the 5'-end 2154 bp promoter fragment. The next deletion mutant designated pDprΔ2446 represented the pDpr without 5'-end 2446 bp promoter sequence. The promoter region of the pDprΔ2446 is 292 bp shorter at the 5'-end than promoter fragment of the pDprΔ2154. The pDprΔ2446 was generated by Sac I/Age I excision of almost full MUC1 promoter followed by insertion into the rest of pDpr sequence of the PCR product that covered the region between -426 and -33 nucleotides of the MUC1 promoter. The primers used for synthesis of the insert were:

  • 5' AATCTAGAGCTC GCTCTGCTTCAGTGG 3' (forward) (the underlined sequence is SacI restriction site)

  • 5' GCTTTATACCGGT CCCCCCACTCCCCG 3' (reverse) (the underlined sequence is AgeI restriction site)

The third promoter deletion mutant, pDprΔ2839, contained only 33 bp MUC1 promoter sequence (-33/+1) and included the TATA-box and several transcription cis-elements. It was constructed by excision of the 5' 2839 bp from the pDpr by Sac I/Age I digestion and ligation of the rest of the pDpr with the Sac I-Age I adapter.

Transient transfection assay

Transient transfection assays were performed in 60 mm Petri dishes. Plasmid DNA (5 μg) was transfected into DA3 cells by Lipofectin as described by the manufacturer. Efficiency of transfection was evaluated by simultaneous transfection of GFP-expression plasmid. After 48 hours cells were harvested for RNA preparation and RT-PCR analysis.

RT-PCR

Total RNA was isolated from the cells using TRIzol Reagent (Gibco BRL). cDNA was synthesized by EZ-First Strand cDNA Synthesis Kit for RT-PCR (Biological Industries, Beit Haemek Ltd, Israel) according to the manufacturer. The complementary DNA products from RT reactions were amplified by PCR in the presence of the appropriate primers:

  • MUC1/SEC (forward): 5' TTCCCAGCCACCACTCTGATACT 3'

  • MUC1/SEC (reverse): 5' AGCATGGGGAAGGAAAGG 3'

  • MUC1/TM (forward): 5' TTCCCAGCCACCACTCTGATACT 3'

  • MUC1/TM (reverse): 5' GACATTGATGGTACCTTCTCG 3'

  • MUC1/Y (forward): 5' GTATAAAACGGAAGCAGCCTCTC 3'

  • MUC1/Y (reverse): 5' GAGAGGCTGCTTCCGTTTTATAC 3'

  • Actin (forward): 5' GTTTGAGACCTTCAACACCCC 3'

  • Actin (reverse): 5' GTGGCCATCTCTTGCTCGAAGTC 3'

The MUC1 and actin specific fragments were amplified using the following PCR conditions: denaturation at 94°C for 5 min, then 35 cycles of 94°C for 45 sec, 50°C for 45 sec and 72°C for 45 sec followed by final primer extention of 72°C for 5 min. All transcripts were analyzed in parallel on at least three separate occasions in a thermal cycler. PCR products were analyzed by electrophoresis on 1.2% agarose gel and visualized by ethidium bromide staining under UV illumination.

Electrophoretic Mobility Shift Assay (EMSA)

EMSA was carried out as described by Promega Protocol [66]. The following oligonucleotides corresponding to ERE present in MUC1 promoter (the bold underlined sequence) in direct (ERE-1 and ERE-6) and inverted (ERE-2, ERE-3, ERE-4 and ERE-5) orientation were annealed with corresponding complementary oligonucleotides and end-labeled with [γ-32P]ATP using T4 polynucleotide kinase.

ERE-1 -2754 5' AGAGGGTGGTCA CCCACCCTTC 3'-2733

ERE-2 -1182 5' TTGAACCCCTGACC TTGTGATCC 3'-1160

ERE-2 mut-1182 5' TTGAACCCCA GACA TTGTGATCC 3'-1160

ERE-3 -755 5' AAGGCTCCCGGTGACC ACTAGAG 3'-736

ERE-4 -389 5' AGTGGGAGACC TAGGGGTGGG 3' -369

ERE-5 -371 5' GGGCTTCCCGACC TTGCTGTA 3'-351

ERE-6 ("putative") -351 5' TACAGGACC T CGACC TAGCTG 3' -332

ERE-6 mut -351 5'TACAA GA TT TCG GA C TAGCTG 3'-332

Vit-ERE 5'TCCAGGTCA CTG TGACC CAAC 3'

Vit-EREmut 5'TCCAGG A C T CTGT A AC G CAAC 3'

Cell nuclear extract was prepared as described [67]. Nuclear extracts (2–5 μg) were incubated in 1 × Gel Shift Binding Buffer (50 mM Tris, pH 7.5/4% glycerol/1 mM MgCl2/0.5 mM EDTA/0.5 mM DTT/50 mM NaCl/0.05 mg/ml poly(dI-dC)poly(dI-dC) at room temperature for 10 minutes, and then 32P-labeled oligonucleotides (80,000 cpm) were added and incubation at room temperature was continued for 20 minutes. The anti-ERα antibody [anti-ERα Ab (D-12), catalog # x:sc-8005X, Santa Cruz Biotechnology] used in the study were raised against DNA-binding domain of human ERα (amino acids 2–185 mapping at the N-terminus). Incubation of the binding reaction mixture with anti-ERα Ab was performed for 1 hr at room temperature or overnight at 4°C before adding labeled ("hot") oligonucleotides. Competing non-labeled ("cold") oligonucleotides, or non-relevant OCT1 oligonucleotide were added to reactions simultaneously with "hot" 32P-ERE oligonucleotide probe. 1 μl of 10× loading buffer was added per reaction to stop binding and reaction products were analyzed by electrophoresis in 6% DNA retardation gel in 0.5 × TBE buffer at 290 V. Gel was dried on a gel dryer and exposed to Kodak X-ray film at -70°C with an intensifying screen.

Statistics

All transfection assays and expression PCR analysis as well as EMSA experiments were performed in parallel on at least three separate occasions.

Abbreviation

All abbreviation of transcription factors and corresponding cis-elements are from [63, 64].

References

  1. Gendler SJ, Spicer AP: Epithelial mucin genes. Annu Rev Physiol. 1995, 57: 607-634. 10.1146/annurev.ph.57.030195.003135

    Article  CAS  PubMed  Google Scholar 

  2. Zaretsky JZ, Weiss M, Tsarfaty I, Hareuveni M, Wreschner DH, Keydar I: Expression of genes coding for pS2, c-erbB2, estrogen receptor and the H23 breast tumor-associated antigen. A comparative analysis in breast cancer. FEBS Lett. 1990, 265 (1-2): 46-50. 10.1016/0014-5793(90)80880-R

    Article  CAS  PubMed  Google Scholar 

  3. Hilkens J, Vos HL, Wesseling J, Boer M, Storm J, van der Valk S, Calafat J, Patriarca C: Is episialin/MUC1 involved in breast cancer progression?. Cancer Lett. 1995, 90 (1): 27-33. 10.1016/0304-3835(94)03674-8

    Article  CAS  PubMed  Google Scholar 

  4. Wreschner DH, Hareuveni M, Tsarfaty I, Smorodinsky N, Horev J, Zaretsky J, Kotkes P, Weiss M, Lathe R, Dion A: Human epithelial tumor antigen cDNA sequences. Differential splicing may generate multiple protein forms. Eur J Biochem. 1990, 189 (3): 463-473. 10.1111/j.1432-1033.1990.tb15511.x

    Article  CAS  PubMed  Google Scholar 

  5. Kamoshida S, Tsutsumi Y: Expression of MUC-1 glycoprotein in plasma cells, follicular dendritic cells, myofibroblasts and perineurial cells: immunohistochemical analysis using three monoclonal antibodies. Pathol Int. 1998, 48 (10): 776-785.

    Article  CAS  PubMed  Google Scholar 

  6. Agrawal B, Krantz MJ, Parker J, Longenecker BM: Expression of MUC1 mucin on activated human T cells: implications for a role of MUC1 in normal immune regulation. Cancer Res. 1998, 58 (18): 4079-4081.

    CAS  PubMed  Google Scholar 

  7. Levitin F, Baruch A, Weiss M, Stiegman K, Hartmann ML, Yoeli-Lerner M, Ziv R, Zrihan-Licht S, Shina S, Gat A, Lifschitz B, Simha M, Stadler Y, Cholostoy A, Gil B, Greaves D, Keydar I, Zaretsky J, Smorodinsky N, Wreschner DH: A novel protein derived from the MUC1 gene by alternative splicing and frameshifting. J Biol Chem. 2005, 280 (11): 10655-10663. 10.1074/jbc.M406943200

    Article  CAS  PubMed  Google Scholar 

  8. Baruch A, Hartmann M, Yoeli M, Adereth Y, Greenstein S, Stadler Y, Skornik Y, Zaretsky J, Smorodinsky NI, Keydar I, Wreschner DH: The breast cancer-associated MUC1 gene generates both a receptor and its cognate binding protein. Cancer Res. 1999, 59 (7): 1552-1561.

    CAS  PubMed  Google Scholar 

  9. Hudson MJ, Stamp GW, Chaudhary KS, Hewitt R, Stubbs AP, Abel PD, Lalani EN: Human MUC1 mucin: a potent glandular morphogen. J Pathol. 2001, 194 (3): 373-383. 10.1002/1096-9896(200107)194:3<373::AID-PATH898>3.0.CO;2-6

    Article  CAS  PubMed  Google Scholar 

  10. Obermair A, Schmid BC, Packer LM, Leodolter S, Birner P, Ward BG, Crandon AJ, McGuckin MA, Zeillinger R: Expression of MUC1 splice variants in benign and malignant ovarian tumours. Int J Cancer. 2002, 100 (2): 166-171. 10.1002/ijc.10456

    Article  CAS  PubMed  Google Scholar 

  11. Zaretsky JZ, Sarid R, Aylon Y, Mittelman LA, Wreschner DH, Keydar I: Analysis of the promoter of the MUC1 gene overexpressed in breast cancer. FEBS Lett. 1999, 461 (3): 189-195. 10.1016/S0014-5793(99)01452-0

    Article  CAS  PubMed  Google Scholar 

  12. Fedorova L, Fedorov A: Introns in gene evolution. Genetica. 2003, 118 (2-3): 123-131. 10.1023/A:1024145407467

    Article  CAS  PubMed  Google Scholar 

  13. Grzybowska EA, Wilczynska A, Siedlecki JA: Regulatory functions of 3'UTRs. Biochem Biophys Res Commun. 2001, 288 (2): 291-295. 10.1006/bbrc.2001.5738

    Article  CAS  PubMed  Google Scholar 

  14. White R, Lees JA, Needham M, Ham J, Parker M: Structural organization and expression of the mouse estrogen receptor. Mol Endocrinol. 1987, 1 (10): 735-744.

    Article  CAS  PubMed  Google Scholar 

  15. Ramadoss P, Perdew GH: Use of 2-azido-3-[125I]iodo-7, 8-dibromodibenzo-p-dioxin as a probe to determine the relative ligand affinity of human versus mouse aryl hydrocarbon receptor in cultured cells. Mol Pharmacol. 2004, 66 (1): 129-136. 10.1124/mol.66.1.129

    Article  CAS  PubMed  Google Scholar 

  16. Meseguer M, Aplin JD, Caballero-Campo P, O'Connor JE, Martin JC, Remohi J, Pellicer A, Simon C: Human endometrial mucin MUC1 is up-regulated by progesterone and down-regulated in vitro by the human blastocyst. Biol Reprod. 2001, 64 (2): 590-601. 10.1095/biolreprod64.2.590

    Article  CAS  PubMed  Google Scholar 

  17. McGuckin MA, Quin RJ, Ward BG: Progesterone stimulates production and secretion of MUC1 epithelial mucin in steroid-responsive breast cancer cell lines. Int J Oncol. 1998, 12 (4): 939-945.

    CAS  PubMed  Google Scholar 

  18. Zhou X, DeSouza MM, Julian J, Gendler SJ, Carson DD: Estrogen receptor does not directly regulate the murine Muc-1 promoter. Mol Cell Endocrinol. 1998, 143 (1-2): 65-78. 10.1016/S0303-7207(98)00141-5

    Article  CAS  PubMed  Google Scholar 

  19. Surveyor GA, Gendler SJ, Pemberton L, Das SK, Chakraborty I, Julian J, Pimental RA, Wegner CC, Dey SK, Carson DD: Expression and steroid hormonal control of Muc-1 in the mouse uterus. Endocrinology. 1995, 136 (8): 3639-3647. 10.1210/en.136.8.3639

    CAS  PubMed  Google Scholar 

  20. Botti C, Seregni E, Lombardo C, Massaron S, Bombardieri E: Effects of steroid-free fetal serum and steroid supplementation on MUC1 gene expression in human breast cancer cell line MCF7. Anticancer Res. 1997, 17 (1A): 205-208.

    CAS  PubMed  Google Scholar 

  21. Breathnach R, Chambon P: Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem. 1981, 50: 349-383. 10.1146/annurev.bi.50.070181.002025

    Article  CAS  PubMed  Google Scholar 

  22. Briggs MR, Kadonaga JT, Bell SP, Tjian R: Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science. 1986, 234 (4772): 47-52. 10.1126/science.3529394

    Article  CAS  PubMed  Google Scholar 

  23. Smale ST, Baltimore D: The "initiator" as a transcription control element. Cell. 1989, 57 (1): 103-113. 10.1016/0092-8674(89)90176-1

    Article  CAS  PubMed  Google Scholar 

  24. Leondires MP, Hu ZZ, Dong J, Tsai-Morris CH, Dufau ML: Estradiol stimulates expression of two human prolactin receptor isoforms with alternative exons-1 in T47D breast cancer cells. J Steroid Biochem Mol Biol. 2002, 82 (2-3): 263-268. 10.1016/S0960-0760(02)00184-X

    Article  CAS  PubMed  Google Scholar 

  25. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU: An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell. 1986, 46 (7): 1053-1061. 10.1016/0092-8674(86)90705-1

    Article  CAS  PubMed  Google Scholar 

  26. Yi P, Driscoll MD, Huang J, Bhagat S, Hilf R, Bambara RA, Muyan M: The effects of estrogen-responsive element- and ligand-induced structural changes on the recruitment of cofactors and transcriptional responses by ER alpha and ER beta. Mol Endocrinol. 2002, 16 (4): 674-693. 10.1210/me.16.4.674

    CAS  PubMed  Google Scholar 

  27. Cavailles V, Augereau P, Rochefort H: Cathepsin D gene is controlled by a mixed promoter, and estrogens stimulate only TATA-dependent transcription in breast cancer cells. Proc Natl Acad Sci U S A. 1993, 90 (1): 203-207. 10.1073/pnas.90.1.203

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  28. Shiraga T, Winpenny JP, Carter EJ, McCarthy VA, Hollingsworth MA, Harris A: MZF-1 and DbpA interact with DNase I hypersensitive sites that correlate with expression of the human MUC1 mucin gene. Exp Cell Res. 2005, 308 (1): 41-52. 10.1016/j.yexcr.2005.04.008

    Article  CAS  PubMed  Google Scholar 

  29. Morris JR, Taylor-Papadimitriou J: The Sp1 transcription factor regulates cell type-specific transcription of MUC1. DNA Cell Biol. 2001, 20 (3): 133-139. 10.1089/104454901300068942

    Article  CAS  PubMed  Google Scholar 

  30. Gaemers IC, Vos HL, Volders HH, van der Valk SW, Hilkens J: A stat-responsive element in the promoter of the episialin/MUC1 gene is involved in its overexpression in carcinoma cells. J Biol Chem. 2001, 276 (9): 6191-6199. 10.1074/jbc.M009449200

    Article  CAS  PubMed  Google Scholar 

  31. Meier VS, Groner B: The nuclear factor YY1 participates in repression of the beta-casein gene promoter in mammary epithelial cells and is counteracted by mammary gland factor during lactogenic hormone induction. Mol Cell Biol. 1994, 14 (1): 128-137.

    PubMed Central  CAS  PubMed  Google Scholar 

  32. Shirotani K, Taylor-Papadimitriou J, Gendler SJ, Irimura T: Transcriptional regulation of the MUC1 mucin gene in colon carcinoma cells by a soluble factor. Identification of a regulatory element. J Biol Chem. 1994, 269 (21): 15030-15035.

    CAS  PubMed  Google Scholar 

  33. Mink S, Hartig E, Jennewein P, Doppler W, Cato AC: A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor. Mol Cell Biol. 1992, 12 (11): 4906-4918.

    PubMed Central  CAS  PubMed  Google Scholar 

  34. Oettgen P, Alani RM, Barcinski MA, Brown L, Akbarali Y, Boltax J, Kunsch C, Munger K, Libermann TA: Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family. Mol Cell Biol. 1997, 17 (8): 4419-4433.

    PubMed Central  CAS  PubMed  Google Scholar 

  35. Abe M, Kufe D: Characterization of cis-acting elements regulating transcription of the human DF3 breast carcinoma-associated antigen (MUC1) gene. Proc Natl Acad Sci U S A. 1993, 90 (1): 282-286. 10.1073/pnas.90.1.282

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  36. Kovarik A, Peat N, Wilson D, Gendler SJ, Taylor-Papadimitriou J: Analysis of the tissue-specific promoter of the MUC1 gene. J Biol Chem. 1993, 268 (13): 9917-9926.

    CAS  PubMed  Google Scholar 

  37. Taylor CM, Blanchard B, Zava DT: Estrogen receptor-mediated and cytotoxic effects of the antiestrogens tamoxifen and 4-hydroxytamoxifen. Cancer Res. 1984, 44 (4): 1409-1414.

    CAS  PubMed  Google Scholar 

  38. Kalkhoven E, Kwakkenbos-Isbrucker L, de Laat SW, van der Saag PT, van der Burg B: Synthetic progestins induce proliferation of breast tumor cell lines via the progesterone or estrogen receptor. Mol Cell Endocrinol. 1994, 102 (1-2): 45-52. 10.1016/0303-7207(94)90096-5

    Article  CAS  PubMed  Google Scholar 

  39. Donaghue C, Westley BR, May FE: Selective promoter usage of the human estrogen receptor-alpha gene and its regulation by estrogen. Mol Endocrinol. 1999, 13 (11): 1934-1950. 10.1210/me.13.11.1934

    CAS  PubMed  Google Scholar 

  40. Hurd C, Khattree N, Dinda S, Alban P, Moudgil VK: Regulation of tumor suppressor proteins, p53 and retinoblastoma, by estrogen and antiestrogens in breast cancer cells. Oncogene. 1997, 15 (8): 991-995. 10.1038/sj.onc.1201233

    Article  CAS  PubMed  Google Scholar 

  41. Hanson JM, BroweIl DA, Cunliffe WJ, Varma J, Allen A, Hemming D, Shenton BK, Young JR, Higgs MJ, Brotherick I, Pearson JP: MUC1 expression in primary breast cancer: the effect of tamoxifen treatment. Breast Cancer Res Treat. 2001, 67 (3): 215-222. 10.1023/A:1017955726902

    Article  CAS  PubMed  Google Scholar 

  42. Paszkiewicz-Gadek A, Porowska H, Anchim T, Wolczynski S, Gindzienski A: Biosynthesis of MUC1 mucin in human endometrial adenocarcinoma is modulated by estradiol and tamoxifen. Gynecol Endocrinol. 2003, 17 (1): 37-44.

    Article  CAS  PubMed  Google Scholar 

  43. Anolik JH, Klinge CM, Brolly CL, Bambara RA, Hilf R: Stability of the ligand-estrogen receptor interaction depends on estrogen response element flanking sequences and cellular factors. J Steroid Biochem Mol Biol. 1996, 59 (5-6): 413-429. 10.1016/S0960-0760(96)00129-X

    Article  CAS  PubMed  Google Scholar 

  44. Nardulli AM, Romine LE, Carpo C, Greene GL, Rainish B: Estrogen receptor affinity and location of consensus and imperfect estrogen response elements influence transcription activation of simplified promoters. Mol Endocrinol. 1996, 10 (6): 694-704. 10.1210/me.10.6.694

    CAS  PubMed  Google Scholar 

  45. Nardulli AM, Grobner C, Cotter D: Estrogen receptor-induced DNA bending: orientation of the bend and replacement of an estrogen response element with an intrinsic DNA bending sequence. Mol Endocrinol. 1995, 9 (8): 1064-1076. 10.1210/me.9.8.1064

    CAS  PubMed  Google Scholar 

  46. Alam MN, Berhane K, Boggaram V: Lung surfactant protein B promoter function is dependent on the helical phasing, orientation and combinatorial actions of cis-DNA elements. Gene. 2002, 282 (1-2): 103-111. 10.1016/S0378-1119(01)00844-7

    Article  CAS  PubMed  Google Scholar 

  47. Krieg SA, Krieg AJ, Shapiro DJ: A unique downstream estrogen responsive unit mediates estrogen induction of proteinase inhibitor-9, a cellular inhibitor of IL-1beta- converting enzyme (caspase 1). Mol Endocrinol. 2001, 15 (11): 1971-1982. 10.1210/me.15.11.1971

    CAS  PubMed  Google Scholar 

  48. Bahadur U, Ganjam GK, Vasudevan N, Kondaiah P: Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor. Mol Cell Endocrinol. 2005, 231 (1-2): 1-11. 10.1016/j.mce.2004.12.007

    Article  CAS  PubMed  Google Scholar 

  49. May FE, Westley BR: Estrogen regulated messenger RNAs in human breast cancer cells. Biomed Pharmacother. 1995, 49 (9): 400-414. 10.1016/0753-3322(96)82677-1

    Article  CAS  PubMed  Google Scholar 

  50. Kato S, Sasaki H, Suzawa M, Masushige S, Tora L, Chambon P, Gronemeyer H: Widely spaced, directly repeated PuGGTCA elements act as promiscuous enhancers for different classes of nuclear receptors. Mol Cell Biol. 1995, 15 (11): 5858-5867.

    PubMed Central  CAS  PubMed  Google Scholar 

  51. Treilleux, Peloux N, Brown M, Sergeant A: Human estrogen receptor (ER) gene promoter-P1: estradiol-independent activity and estradiol inducibility in ER+ and ER- cells. Mol Endocrinol. 1997, 11 (9): 1319-1331. 10.1210/me.11.9.1319

    CAS  PubMed  Google Scholar 

  52. Hall JM, McDonnell DP, Korach KS: Allosteric regulation of estrogen receptor structure, function, and coactivator recruitment by different estrogen response elements. Mol Endocrinol. 2002, 16 (3): 469-486. 10.1210/me.16.3.469

    Article  CAS  PubMed  Google Scholar 

  53. Lefstin JA, Yamamoto KR: Allosteric effects of DNA on transcriptional regulators. Nature. 1998, 392 (6679): 885-888. 10.1038/31860

    Article  CAS  PubMed  Google Scholar 

  54. Wood JR, Greene GL, Nardulli AM: Estrogen response elements function as allosteric modulators of estrogen receptor conformation. Mol Cell Biol. 1998, 18 (4): 1927-1934.

    PubMed Central  CAS  PubMed  Google Scholar 

  55. Wood JR, Likhite VS, Loven MA, Nardulli AM: Allosteric modulation of estrogen receptor conformation by different estrogen response elements. Mol Endocrinol. 2001, 15 (7): 1114-1126. 10.1210/me.15.7.1114

    Article  CAS  PubMed  Google Scholar 

  56. Gottlicher M, Heck S, Herrlich P: Transcriptional cross-talk, the second mode of steroid hormone receptor action. J Mol Med. 1998, 76 (7): 480-489. 10.1007/s001090050242

    Article  CAS  PubMed  Google Scholar 

  57. Cramer P, Pesce CG, Baralle FE, Kornblihtt AR: Functional association between promoter structure and transcript alternative splicing. Proc Natl Acad Sci U S A. 1997, 94 (21): 11456-11460. 10.1073/pnas.94.21.11456

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  58. Chang ML, Chen JC, Alonso CR, Kornblihtt AR, Bissell DM: Regulation of fibronectin splicing in sinusoidal endothelial cells from normal or injured liver. Proc Natl Acad Sci U S A. 2004, 101 (52): 18093-18098. 10.1073/pnas.0408439102

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  59. Kornblihtt AR, de la Mata M, Fededa JP, Munoz MJ, Nogues G: Multiple links between transcription and splicing. Rna. 2004, 10 (10): 1489-1498. 10.1261/rna.7100104

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  60. Cramer P, Srebrow A, Kadener S, Werbajh S, de la Mata M, Melen G, Nogues G, Kornblihtt AR: Coordination between transcription and pre-mRNA processing. FEBS Lett. 2001, 498 (2-3): 179-182. 10.1016/S0014-5793(01)02485-1

    Article  CAS  PubMed  Google Scholar 

  61. Cramer P, Caceres JF, Cazalla D, Kadener S, Muro AF, Baralle FE, Kornblihtt AR: Coupling of transcription with alternative splicing: RNA pol II promoters modulate SF2/ASF and 9G8 effects on an exonic splicing enhancer. Mol Cell. 1999, 4 (2): 251-258. 10.1016/S1097-2765(00)80372-X

    Article  CAS  PubMed  Google Scholar 

  62. Mortillaro MJ, Blencowe BJ, Wei X, Nakayasu H, Du L, Warren SL, Sharp PA, Berezney R: A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix. Proc Natl Acad Sci U S A. 1996, 93 (16): 8253-8257. 10.1073/pnas.93.16.8253

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  63. TRANSFAC. [http://www.gene-regulation.com/pub/databases.html#transfac]

  64. TSSG. [http://www.softberry.com/berry.phtml?topic=tssg%26group=help%26subgroup=promoter]

  65. Lathe R, Vilotte JL, Clark AJ: Plasmid and bacteriophage vectors for excision of intact inserts. Gene. 1987, 57 (2-3): 193-201. 10.1016/0378-1119(87)90122-3

    Article  CAS  PubMed  Google Scholar 

  66. www.promega.com: Promega Technical Bulletin No. 110 .

  67. Haspel RL, Darnell JE: A nuclear protein tyrosine phosphatase is required for the inactivation of Stat1. Proc Natl Acad Sci U S A. 1999, 96 (18): 10188-10193. 10.1073/pnas.96.18.10188

    Article  PubMed Central  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Dr. Zeev Zaslavsky for help in computer design of the cis-element map. This work was supported by the Israel Cancer Association grant (J.Z.Z), the Susan Komen Breast Cancer Foundation (D.H.W), the Simco Chair for Breast Cancer Research, the Federico Fund for Tel Aviv University and the Barbara Friedman Fund (I.K.).

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Joseph Z Zaretsky.

Additional information

Competing interests

We think that there may be competing interests between our group and Dr. S. Gendler and Dr. D. Carson groups. Studying the role of estrogen receptors (ER) in transcriptional regulation of the mouse MUC1 gene, Zhou X, DeSouza MM, Julian J, Gendler SJ and Carson DD (Mol Cell Endocrinol 1998, 143:65–78) concluded that ER did not bind directly to the cis-ERE in murine MUC1 promoter. In contrast to the results obtained by these authors in mouse system, we found that all cis-ERE detected in human MUC1 promoter could form complexes with human ERα in vitro. Several factors that may explain this discrepancy are discussed in our manuscript.

Authors' contributions

JZZ designed the study, constructed the MUC1 promoter cis-element map, performed transfection assays, PCR analysis of MUC1 expression in transfected cells and in human epithelial cells treated with estrogen and 4-OHT, EMSA experiments and drafted the manuscript. IB performed 32P-labeled oligonucleotides, part of EMSA experiments depicted in Fig. 4 and participated in computer analysis of the MUC1 promoter. YA generated plasmids pDprΔ2154, pDprΔ2446 and pDprΔ2839 and participated in transfection assays. MG performed part of computer analysis of the MUC1 promoter cis-elements. DHW prepared pDpr plasmid, participated in design of the study and analyzing of the results. IK designed part of the study, performed T47D cell analysis, selected clones 8 and 10, participated in experiments depicted in Fig. 3. All authors read and approved the manuscript.

Electronic supplementary material

12943_2006_189_MOESM1_ESM.pdf

Additional file 1: The map of transcription factor cis-elements present in the MUC1 promoter. The file contains part of the "map" that represents promoter sequence -2872/-1913. (PDF 34 KB)

12943_2006_189_MOESM2_ESM.pdf

Additional file 2: The map of transcription factor cis-elements present in the MUC1 promoter. The file contains part of the "map" that represents promoter sequence -1912/-713 (PDF 32 KB)

12943_2006_189_MOESM3_ESM.pdf

Additional file 3: The map of transcription factor cis-elements present in the MUC1 promoter. The file contains part of the "map" that represents promoter sequence -712/+69 (PDF 35 KB)

Authors’ original submitted files for images

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Zaretsky, J.Z., Barnea, I., Aylon, Y. et al. MUC1 gene overexpressed in breast cancer: structure and transcriptional activity of the MUC1 promoter and role of estrogen receptor alpha (ERα) in regulation of the MUC1 gene expression. Mol Cancer 5, 57 (2006). https://doi.org/10.1186/1476-4598-5-57

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1476-4598-5-57

Keywords